Error in nma.pdb(pdb) : nma: insufficient number of atoms?

[Sebastian S]

Hello, I'm kind of new to bio3d so it may be a basic question. I'm trying to perform normal mode analysis on a dna I have created in Amber as follows: nuc.nab file: molecule m; m = fd_helix( "abdna", "CGTACGGCTA", "dna" ); putpdb( "nuc.pdb", m, "-wwpdb");

nab nuc.nab ./a.out

Then, I load it into R

pdb<-read.pdb("nuc.pdb") And I see that it has loaded correctly:

pdb

Call: read.pdb(file = "nuc.pdb")

Total Models#: 1 Total Atoms#: 632, XYZs#: 1896 Chains#: 1 (values: NA)

 Protein Atoms#: 0  (residues/Calpha atoms#: 0)
 Nucleic acid Atoms#: 632  (residues/phosphate atoms#: 20)

 Non-protein/nucleic Atoms#: 0  (residues: 0)
 Non-protein/nucleic resid values: [ none ]

Nucleic acid sequence: CGTACGGCTATAGCCGTACG

• attr: atom, helix, sheet, seqres, xyz, calpha, remark, call

However, when I try to run nmd I get the following error:

modes<-nma(pdb) Error in nma.pdb(pdb) : nma: insufficient number of atoms

Am I doing something wrong?

Regards, Sebastian

[Xinqiu Yao]

Hi Sebastian,

Currently the normal mode analysis in Bio3D only supports protein structure...

[Sebastian S]

Thanks for your reply! What a pity, are there plans in the future to include DNA? Does Bio3D PCA support DNA?

[Lars Skjærven]

Sorry, no plans for DNA/RNA-NMA at the moment. Note that you can probably run all-atom NMA on a DNA system. I've never tried, but it might work. Note that you then need to set outmodes="noh".

PCA (see function pca.xyz) can be performed on any trajectory (xyz) data set.