Error in nma.pdb(pdb) : nma: insufficient number of atoms?
Hello, I'm kind of new to bio3d so it may be a basic question. I'm trying to perform normal mode analysis on a dna I have created in Amber as follows: nuc.nab file: molecule m; m = fd_helix( "abdna", "CGTACGGCTA", "dna" ); putpdb( "nuc.pdb", m, "-wwpdb");
nab nuc.nab ./a.out
Then, I load it into R
pdb<-read.pdb("nuc.pdb") And I see that it has loaded correctly:
pdb
Call: read.pdb(file = "nuc.pdb")
Total Models#: 1 Total Atoms#: 632, XYZs#: 1896 Chains#: 1 (values: NA)
Protein Atoms#: 0 (residues/Calpha atoms#: 0)
Nucleic acid Atoms#: 632 (residues/phosphate atoms#: 20)
Non-protein/nucleic Atoms#: 0 (residues: 0)
Non-protein/nucleic resid values: [ none ]
Nucleic acid sequence: CGTACGGCTATAGCCGTACG
- attr: atom, helix, sheet, seqres, xyz, calpha, remark, call
However, when I try to run nmd I get the following error:
modes<-nma(pdb) Error in nma.pdb(pdb) : nma: insufficient number of atoms
Am I doing something wrong?
Regards, Sebastian
Comments (4)
-
-
reporter Thanks for your reply! What a pity, are there plans in the future to include DNA? Does Bio3D PCA support DNA?
-
Sorry, no plans for DNA/RNA-NMA at the moment. Note that you can probably run all-atom NMA on a DNA system. I've never tried, but it might work. Note that you then need to set outmodes="noh".
PCA (see function pca.xyz) can be performed on any trajectory (xyz) data set.
-
- changed status to resolved
- Log in to comment
Hi Sebastian,
Currently the normal mode analysis in Bio3D only supports protein structure...