1. CBBIO
  2. Untitled project
  3. miARma

Source

miARma / Examples / basic_examples / miRNAs / DeNovo_miRNAs / miARma_miRNAs_DeNovo.ini

;General parameters
[General]
; type of analysis (miRNA, mRNA or circRNA)
type=miRNA
;0 for no verbose, otherwise to print "almost" everything
verbose=0
; Folder for miRNA reads
read_dir=Examples/basic_examples/miRNAs/reads/
; Number of process to run at the same time
threads=4
; label for the analsysis
label=Hypoxia
; Folder where miARma has been instaled
miARmaPath=.
; Folder to store results
output_dir=Examples/basic_examples/miRNAs/DeNovo_miRNAs/results/
; organism used
organism=human

;Stats file where stats data will be saved
[Quality]
;Character string to put in the name of the results directory
prefix=Pre

[DeNovo]
;Indexed genome to align your reads in format .ebwt (Mandatory for analysis with miRDeep)
bowtie1index=Genomes/Indexes/bowtie1/human/bw1_homo_sapiens19
;Adapter to trimm at read 3'
adapter=ATCTCGTATGCCGTCTTCTGCTTGAA
;a fasta file with all mature sequence from your organism
mature_miRNA_file=Examples/basic_examples/miRNAs/data/hsa_mature_miRBase20.fasta
;a fasta file with all known pre-miRNa sequence
precursor_miRNA_file=Examples/basic_examples/miRNAs/data/precursors_miRBase20.fasta
;fasta file for the cmplete genome of our organism
genome=Genomes/Indexes/bowtie1/human/homo_sapiens19.fa

[DEAnalysis]
; Complete path of the target file.
targetfile=Examples/basic_examples/miRNAs/data/targets.txt
; Path of the contrast file.
contrastfile=Examples/basic_examples/miRNAs/data/contrast.txt
#This value refers to filter processing in the reads (Should be "yes" or "no").
filter=yes
;Specific software to perform the Differential Expression Analysis (Allowed values: edger, noiseq or edger-noiseq)
desoft=EdgeR-Noiseq
; providing replicates
replicates=yes

[TargetPrediction]
; #Optional argument to select statistically significant results. 0.8 as default
noiseq_cutoff=0.8
; #Optional argument to select statistically significant results. 0.05 as default
edger_cutoff=0.05