Source

Cistrome-Harvard / test-data / lastz_paired_input3.fasta

The default branch has multiple heads

Full commit
>linker
TCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACG