Commits

Ross Lazarus  committed 9644cbe

picard as metrics test outputs and test tweaks to try to get around buildbot

  • Participants
  • Parent commits da55aed

Comments (0)

Files changed (2)

File test-data/picard_output_alignment_summary_metrics.html

 <html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en">
 <head>
 <meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
-<meta name="generator" content="Galaxy rgPicardASMetrics.py tool output - see http://g2.trac.bx.psu.edu/" />
+<meta name="generator" content="Galaxy picard_wrapper tool output - see http://getgalaxy.org/" />
 <title></title>
 <link rel="stylesheet" href="/static/style/base.css" type="text/css" />
 </head>
 <body>
 <div class="document">
-<b><a href="http://rgenetics.org">Galaxy Rgenetics</a> tool output rgPicardASMetrics.py run at 10/04/2011 14:49:13</b><b>Your job produced the following output files.</b><hr/>
-<table>
-<tr><td><a href="picardAlignSumMetrics_out.txt">picardAlignSumMetrics_out.txt</a></td></tr>
+Galaxy tool wrapper run picard_wrapper at 08/05/2011 21:08:01</b><br/><b>The following output files were created (click the filename to view/download a copy):</b><hr/><table>
+<tr><td><a href="CollectAlignmentSummaryMetrics.metrics.txt">CollectAlignmentSummaryMetrics.metrics.txt</a></td></tr>
 </table><p/>
-<b>Picard on line resources</b><ul>
+<b>Picard on line resources:</b><ul>
 <li><a href="http://picard.sourceforge.net/index.shtml">Click here for Picard Documentation</a></li>
 <li><a href="http://picard.sourceforge.net/picard-metric-definitions.shtml">Click here for Picard Metrics definitions</a></li></ul><hr/>
 <b>Picard output (transposed to make it easier to see)</b><hr/>
 <table cellpadding="3" >
-<tr class="d0"><td>## net.sf.picard.metrics.StringHeader</td></tr><tr class="d1"><td># net.sf.picard.analysis.CollectAlignmentSummaryMetrics MAX_INSERT_SIZE=100000 ADAPTER_SEQUENCE=[AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG, IS_BISULFITE_SEQUENCED=false] INPUT=/export/tmp/tmpBfU1Um/database/files/000/dataset_89.dat OUTPUT=/udd/rerla/rgalaxy/database/job_working_directory/88/dataset_90_files/picardAlignSumMetrics_out.txt ASSUME_SORTED=true TMP_DIR=/tmp VALIDATION_STRINGENCY=LENIENT    IS_BISULFITE_SEQUENCED=false STOP_AFTER=0 VERBOSITY=INFO QUIET=false COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false</td></tr><tr class="d0"><td>## net.sf.picard.metrics.StringHeader</td></tr><tr class="d1"><td># Started on: Sun Apr 10 14:49:13 EDT 2011</td></tr><tr class="d0"><td>## METRICS CLASS	net.sf.picard.analysis.AlignmentSummaryMetrics</td></tr><tr class="d0"><td>CATEGORY</td><td>FIRST_OF_PAIR</td></tr>
+<tr class="d0"><td>## net.sf.picard.metrics.StringHeader</td></tr><tr class="d1"><td># net.sf.picard.analysis.CollectAlignmentSummaryMetrics MAX_INSERT_SIZE=100000 ADAPTER_SEQUENCE=[AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG, IS_BISULFITE_SEQUENCED=false] INPUT=/export/tmp/tmpNfOoN9/database/files/000/dataset_2.dat OUTPUT=/udd/rerla/galaxy-central/database/job_working_directory/3/dataset_3_files/CollectAlignmentSummaryMetrics.metrics.txt REFERENCE_SEQUENCE=/udd/rerla/galaxy-central/database/job_working_directory/3/dataset_3_files/CollectAlignmentSummaryMetrics2ZaS1j.fasta_fake.fasta ASSUME_SORTED=true TMP_DIR=/tmp VALIDATION_STRINGENCY=LENIENT    IS_BISULFITE_SEQUENCED=false STOP_AFTER=0 VERBOSITY=INFO QUIET=false COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false</td></tr><tr class="d0"><td>## net.sf.picard.metrics.StringHeader</td></tr><tr class="d1"><td># Started on: Sun May 08 21:08:00 EDT 2011</td></tr><tr class="d0"><td>## METRICS CLASS	net.sf.picard.analysis.AlignmentSummaryMetrics</td></tr><tr class="d0"><td>CATEGORY</td><td>FIRST_OF_PAIR</td></tr>
 <tr class="d1"><td>TOTAL_READS</td><td>4</td></tr>
 <tr class="d0"><td>PF_READS</td><td>4</td></tr>
 <tr class="d1"><td>PCT_PF_READS</td><td>1</td></tr>
 <tr class="d0"><td>PF_NOISE_READS</td><td>0</td></tr>
-<tr class="d1"><td>PF_READS_ALIGNED</td><td>0</td></tr>
-<tr class="d0"><td>PCT_PF_READS_ALIGNED</td><td>0</td></tr>
-<tr class="d1"><td>PF_HQ_ALIGNED_READS</td><td>0</td></tr>
-<tr class="d0"><td>PF_HQ_ALIGNED_BASES</td><td>0</td></tr>
-<tr class="d1"><td>PF_HQ_ALIGNED_Q20_BASES</td><td>0</td></tr>
-<tr class="d0"><td>PF_HQ_MEDIAN_MISMATCHES</td><td>0</td></tr>
-<tr class="d1"><td>PF_HQ_ERROR_RATE</td><td>0</td></tr>
+<tr class="d1"><td>PF_READS_ALIGNED</td><td>4</td></tr>
+<tr class="d0"><td>PCT_PF_READS_ALIGNED</td><td>1</td></tr>
+<tr class="d1"><td>PF_HQ_ALIGNED_READS</td><td>4</td></tr>
+<tr class="d0"><td>PF_HQ_ALIGNED_BASES</td><td>404</td></tr>
+<tr class="d1"><td>PF_HQ_ALIGNED_Q20_BASES</td><td>28</td></tr>
+<tr class="d0"><td>PF_HQ_MEDIAN_MISMATCHES</td><td>78</td></tr>
+<tr class="d1"><td>PF_HQ_ERROR_RATE</td><td>0.777228</td></tr>
 <tr class="d0"><td>MEAN_READ_LENGTH</td><td>101</td></tr>
-<tr class="d1"><td>READS_ALIGNED_IN_PAIRS</td><td>0</td></tr>
-<tr class="d0"><td>PCT_READS_ALIGNED_IN_PAIRS</td><td>0</td></tr>
-<tr class="d1"><td>BAD_CYCLES</td><td>2</td></tr>
-<tr class="d0"><td>STRAND_BALANCE</td><td>0</td></tr>
+<tr class="d1"><td>READS_ALIGNED_IN_PAIRS</td><td>3</td></tr>
+<tr class="d0"><td>PCT_READS_ALIGNED_IN_PAIRS</td><td>0.75</td></tr>
+<tr class="d1"><td>BAD_CYCLES</td><td>63</td></tr>
+<tr class="d0"><td>STRAND_BALANCE</td><td>0.25</td></tr>
 <tr class="d1"><td>PCT_CHIMERAS</td><td>0</td></tr>
 <tr class="d0"><td>PCT_ADAPTER
 </td><td>0
 </td></tr>
 </table>
 <b>Picard log</b><hr/>
-<pre>## executing java -Xmx2g  -jar /udd/rerla/rgalaxy/tool-data/shared/jars/CollectAlignmentSummaryMetrics.jar MAX_INSERT_SIZE=100000 OUTPUT=/udd/rerla/rgalaxy/database/job_working_directory/88/dataset_90_files/picardAlignSumMetrics_out.txt  ADAPTER_SEQUENCE=  IS_BISULFITE_SEQUENCED=false VALIDATION_STRINGENCY=LENIENT INPUT=/export/tmp/tmpBfU1Um/database/files/000/dataset_89.dat ASSUME_SORTED=true TMP_DIR=/tmp returned status 0 and log (stdout/stderr) records: 
-[Sun Apr 10 14:49:13 EDT 2011] net.sf.picard.analysis.CollectAlignmentSummaryMetrics MAX_INSERT_SIZE=100000 ADAPTER_SEQUENCE=[AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG, IS_BISULFITE_SEQUENCED=false] INPUT=/export/tmp/tmpBfU1Um/database/files/000/dataset_89.dat OUTPUT=/udd/rerla/rgalaxy/database/job_working_directory/88/dataset_90_files/picardAlignSumMetrics_out.txt ASSUME_SORTED=true TMP_DIR=/tmp VALIDATION_STRINGENCY=LENIENT    IS_BISULFITE_SEQUENCED=false STOP_AFTER=0 VERBOSITY=INFO QUIET=false COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false
-WARNING	2011-04-10 14:49:13	SinglePassSamProgram	File reports sort order 'queryname', assuming it's coordinate sorted anyway.
-[Sun Apr 10 14:49:13 EDT 2011] net.sf.picard.analysis.CollectAlignmentSummaryMetrics done.
+<pre>## executing java -Xmx2g -jar /udd/rerla/galaxy-central/tool-data/shared/jars/CreateSequenceDictionary.jar REFERENCE=/tmp/CollectAlignmentSummaryMetrics2ZaS1j.fasta OUTPUT=/tmp/CollectAlignmentSummaryMetrics2ZaS1j.dict URI=dataset_1.dat TRUNCATE_NAMES_AT_WHITESPACE=None returned status 0 and stderr: 
+[Sun May 08 21:08:00 EDT 2011] net.sf.picard.sam.CreateSequenceDictionary REFERENCE=/tmp/CollectAlignmentSummaryMetrics2ZaS1j.fasta OUTPUT=/tmp/CollectAlignmentSummaryMetrics2ZaS1j.dict URI=dataset_1.dat TRUNCATE_NAMES_AT_WHITESPACE=false    NUM_SEQUENCES=2147483647 TMP_DIR=/tmp/rerla VERBOSITY=INFO QUIET=false VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false
+[Sun May 08 21:08:00 EDT 2011] net.sf.picard.sam.CreateSequenceDictionary done.
 Runtime.totalMemory()=9109504
 
 
+## executing java -Xmx2g -jar /udd/rerla/galaxy-central/tool-data/shared/jars/CollectAlignmentSummaryMetrics.jar VALIDATION_STRINGENCY=LENIENT ASSUME_SORTED=true  ADAPTER_SEQUENCE= IS_BISULFITE_SEQUENCED=false MAX_INSERT_SIZE=100000 OUTPUT=/udd/rerla/galaxy-central/database/job_working_directory/3/dataset_3_files/CollectAlignmentSummaryMetrics.metrics.txt R=/udd/rerla/galaxy-central/database/job_working_directory/3/dataset_3_files/CollectAlignmentSummaryMetrics2ZaS1j.fasta_fake.fasta TMP_DIR=/tmp INPUT=/export/tmp/tmpNfOoN9/database/files/000/dataset_2.dat returned status 0 and stderr: 
+[Sun May 08 21:08:00 EDT 2011] net.sf.picard.analysis.CollectAlignmentSummaryMetrics MAX_INSERT_SIZE=100000 ADAPTER_SEQUENCE=[AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG, IS_BISULFITE_SEQUENCED=false] INPUT=/export/tmp/tmpNfOoN9/database/files/000/dataset_2.dat OUTPUT=/udd/rerla/galaxy-central/database/job_working_directory/3/dataset_3_files/CollectAlignmentSummaryMetrics.metrics.txt REFERENCE_SEQUENCE=/udd/rerla/galaxy-central/database/job_working_directory/3/dataset_3_files/CollectAlignmentSummaryMetrics2ZaS1j.fasta_fake.fasta ASSUME_SORTED=true TMP_DIR=/tmp VALIDATION_STRINGENCY=LENIENT    IS_BISULFITE_SEQUENCED=false STOP_AFTER=0 VERBOSITY=INFO QUIET=false COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false
+WARNING	2011-05-08 21:08:00	SinglePassSamProgram	File reports sort order 'queryname', assuming it's coordinate sorted anyway.
+[Sun May 08 21:08:01 EDT 2011] net.sf.picard.analysis.CollectAlignmentSummaryMetrics done.
+Runtime.totalMemory()=9109504
+
+
 </pre><hr/>The freely available <a href="http://picard.sourceforge.net/command-line-overview.shtml">Picard software</a> 
-generated all outputs reported here, using this command line:<br/>
-<pre>java -Xmx2g  -jar /udd/rerla/rgalaxy/tool-data/shared/jars/CollectAlignmentSummaryMetrics.jar MAX_INSERT_SIZE=100000 OUTPUT=/udd/rerla/rgalaxy/database/job_working_directory/88/dataset_90_files/picardAlignSumMetrics_out.txt  ADAPTER_SEQUENCE=  IS_BISULFITE_SEQUENCED=false VALIDATION_STRINGENCY=LENIENT INPUT=/export/tmp/tmpBfU1Um/database/files/000/dataset_89.dat ASSUME_SORTED=true TMP_DIR=/tmp</pre>
-</div></body></html>
+generated all outputs reported here running as a <a href="http://getgalaxy.org">Galaxy</a> tool</div></body></html>
 

File tools/picard/rgPicardASMetrics.xml

       <param name="refGenomeSource" value="history" />
       <param name="ownFile" value="picard_input_hg18.trimmed.fasta" />
       <param name="input_file" value="picard_input_tiny.sam" dbkey="hg18" />
-      <output name="html_file" file="picard_output_alignment_summary_metrics.html" ftype="html" lines_diff="50"/>
+      <output name="html_file" file="picard_output_alignment_summary_metrics.html" ftype="html" lines_diff="55"/>
     </test>
     <test>
       <param name="out_prefix" value="AsMetricsIndexed" />
       <param name="sorted" value="true" />
       <param name="adaptors" value="" />
       <param name="maxinsert" value="100000" />
-      <param name="index" value="hg18" />
       <param name="refGenomeSource" value="indexed" />
       <param name="index" value="hg18" />
       <param name="input_file" value="picard_input_sorted_pair.sam" dbkey="hg18" />