galaxy-obo / test-data / picard_output_alignment_summary_metrics.html

The default branch has multiple heads

<style type="text/css">
        tr.d0 td {background-color: oldlace; color: black;}
        tr.d1 td {background-color: aliceblue; color: black;}
        </style><?xml version="1.0" encoding="utf-8" ?>
<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
<html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en">
<head>
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
<meta name="generator" content="Galaxy picard_wrapper tool output - see http://getgalaxy.org/" />
<title></title>
<link rel="stylesheet" href="/static/style/base.css" type="text/css" />
</head>
<body>
<div class="document">
Galaxy tool CollectAlignmentSummaryMetrics run at 11/11/2011 08:07:10</b><br/><b>The following output files were created (click the filename to view/download a copy):</b><hr/><table>
<tr><td><a href="CollectAlignmentSummaryMetrics.log">CollectAlignmentSummaryMetrics.log</a></td></tr>
<tr><td><a href="CollectAlignmentSummaryMetrics.metrics.txt">CollectAlignmentSummaryMetrics.metrics.txt</a></td></tr>
</table><p/>
<b>Picard on line resources</b><ul>
<li><a href="http://picard.sourceforge.net/index.shtml">Click here for Picard Documentation</a></li>
<li><a href="http://picard.sourceforge.net/picard-metric-definitions.shtml">Click here for Picard Metrics definitions</a></li></ul><hr/>
<b>Picard output (transposed to make it easier to see)</b><hr/>
<table cellpadding="3" >
<tr class="d0"><td colspan="2">## net.sf.picard.metrics.StringHeader</td></tr><tr class="d1"><td colspan="2"># net.sf.picard.analysis.CollectAlignmentSummaryMetrics MAX_INSERT_SIZE=100000 ADAPTER_SEQUENCE=[AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG, IS_BISULFITE_SEQUENCED=false] INPUT=/data/tmp/tmpLLcl1w/database/files/000/dataset_2.dat OUTPUT=/data/home/rlazarus/galaxy/database/job_working_directory/3/dataset_3_files/CollectAlignmentSummaryMetrics.metrics.txt REFERENCE_SEQUENCE=/data/home/rlazarus/galaxy/database/job_working_directory/3/dataset_3_files/CollectAlignmentSummaryMetricsfq2hit.fasta_fake.fasta ASSUME_SORTED=true TMP_DIR=[/tmp] VALIDATION_STRINGENCY=LENIENT    METRIC_ACCUMULATION_LEVEL=[ALL_READS] IS_BISULFITE_SEQUENCED=false STOP_AFTER=0 VERBOSITY=INFO QUIET=false COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false</td></tr><tr class="d0"><td colspan="2">## net.sf.picard.metrics.StringHeader</td></tr><tr class="d1"><td colspan="2"># Started on: Fri Nov 11 08:07:10 EST 2011</td></tr><tr class="d0"><td colspan="2">## METRICS CLASS	net.sf.picard.analysis.AlignmentSummaryMetrics</td></tr><tr class="d0"><td>CATEGORY</td><td>FIRST_OF_PAIR&nbsp;</td></tr>
<tr class="d1"><td>TOTAL_READS</td><td>4&nbsp;</td></tr>
<tr class="d0"><td>PF_READS</td><td>4&nbsp;</td></tr>
<tr class="d1"><td>PCT_PF_READS</td><td>1&nbsp;</td></tr>
<tr class="d0"><td>PF_NOISE_READS</td><td>0&nbsp;</td></tr>
<tr class="d1"><td>PF_READS_ALIGNED</td><td>4&nbsp;</td></tr>
<tr class="d0"><td>PCT_PF_READS_ALIGNED</td><td>1&nbsp;</td></tr>
<tr class="d1"><td>PF_ALIGNED_BASES</td><td>404&nbsp;</td></tr>
<tr class="d0"><td>PF_HQ_ALIGNED_READS</td><td>4&nbsp;</td></tr>
<tr class="d1"><td>PF_HQ_ALIGNED_BASES</td><td>404&nbsp;</td></tr>
<tr class="d0"><td>PF_HQ_ALIGNED_Q20_BASES</td><td>28&nbsp;</td></tr>
<tr class="d1"><td>PF_HQ_MEDIAN_MISMATCHES</td><td>78&nbsp;</td></tr>
<tr class="d0"><td>PF_MISMATCH_RATE</td><td>0.777228&nbsp;</td></tr>
<tr class="d1"><td>PF_HQ_ERROR_RATE</td><td>0.777228&nbsp;</td></tr>
<tr class="d0"><td>PF_INDEL_RATE</td><td>0&nbsp;</td></tr>
<tr class="d1"><td>MEAN_READ_LENGTH</td><td>101&nbsp;</td></tr>
<tr class="d0"><td>READS_ALIGNED_IN_PAIRS</td><td>3&nbsp;</td></tr>
<tr class="d1"><td>PCT_READS_ALIGNED_IN_PAIRS</td><td>0.75&nbsp;</td></tr>
<tr class="d0"><td>BAD_CYCLES</td><td>63&nbsp;</td></tr>
<tr class="d1"><td>STRAND_BALANCE</td><td>0.25&nbsp;</td></tr>
<tr class="d0"><td>PCT_CHIMERAS</td><td>0&nbsp;</td></tr>
<tr class="d1"><td>PCT_ADAPTER</td><td>0&nbsp;</td></tr>
<tr class="d0"><td>SAMPLE</td><td>&nbsp;</td></tr>
<tr class="d1"><td>LIBRARY</td><td>&nbsp;</td></tr>
<tr class="d0"><td>READ_GROUP
</td><td>
&nbsp;</td></tr>
</table>
<b>Picard Tool Run Log</b><hr/>
<pre>INFO:root:## executing java -Xmx4g -jar /data/home/rlazarus/galaxy/tool-data/shared/jars/picard/CreateSequenceDictionary.jar REFERENCE=/tmp/CollectAlignmentSummaryMetricsfq2hit.fasta OUTPUT=/tmp/CollectAlignmentSummaryMetricsfq2hit.dict URI=dataset_1.dat TRUNCATE_NAMES_AT_WHITESPACE=None returned status 0 and nothing on stderr

INFO:root:## executing java -Xmx4g -jar /data/home/rlazarus/galaxy/tool-data/shared/jars/picard/CollectAlignmentSummaryMetrics.jar VALIDATION_STRINGENCY=LENIENT ASSUME_SORTED=true  ADAPTER_SEQUENCE= IS_BISULFITE_SEQUENCED=false MAX_INSERT_SIZE=100000 OUTPUT=/data/home/rlazarus/galaxy/database/job_working_directory/3/dataset_3_files/CollectAlignmentSummaryMetrics.metrics.txt R=/data/home/rlazarus/galaxy/database/job_working_directory/3/dataset_3_files/CollectAlignmentSummaryMetricsfq2hit.fasta_fake.fasta TMP_DIR=/tmp INPUT=/data/tmp/tmpLLcl1w/database/files/000/dataset_2.dat returned status 0 and nothing on stderr

</pre><hr/>The freely available <a href="http://picard.sourceforge.net/command-line-overview.shtml">Picard software</a> 
generated all outputs reported here running as a <a href="http://getgalaxy.org">Galaxy</a> tool</div></body></html>
Tip: Filter by directory path e.g. /media app.js to search for public/media/app.js.
Tip: Use camelCasing e.g. ProjME to search for ProjectModifiedEvent.java.
Tip: Filter by extension type e.g. /repo .js to search for all .js files in the /repo directory.
Tip: Separate your search with spaces e.g. /ssh pom.xml to search for src/ssh/pom.xml.
Tip: Use ↑ and ↓ arrow keys to navigate and return to view the file.
Tip: You can also navigate files with Ctrl+j (next) and Ctrl+k (previous) and view the file with Ctrl+o.
Tip: You can also navigate files with Alt+j (next) and Alt+k (previous) and view the file with Alt+o.