Source

galaxy-obo / test-data / picard_output_collect_AS_sorted_pair.txt

The default branch has multiple heads

Full commit
## net.sf.picard.metrics.StringHeader
# net.sf.picard.analysis.CollectAlignmentSummaryMetrics INPUT=testdata/picard/sam/bam2fastq/paired/ok/sorted-pair.sam OUTPUT=output_test_as/test_as_sorted-pair.txt REFERENCE_SEQUENCE=testdata/picard/reference/Homo_sapiens_assembly18.trimmed.fasta    ASSUME_SORTED=true MAX_INSERT_SIZE=100000 ADAPTER_SEQUENCE=[AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG] IS_BISULFITE_SEQUENCED=false TMP_DIR=/tmp/raphael VERBOSITY=INFO QUIET=false VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false
## net.sf.picard.metrics.StringHeader
# Started on: Tue Oct 26 14:06:32 EDT 2010

## METRICS CLASS	net.sf.picard.analysis.AlignmentSummaryMetrics
CATEGORY	TOTAL_READS	PF_READS	PCT_PF_READS	PF_NOISE_READS	PF_READS_ALIGNED	PCT_PF_READS_ALIGNED	PF_HQ_ALIGNED_READS	PF_HQ_ALIGNED_BASES	PF_HQ_ALIGNED_Q20_BASES	PF_HQ_MEDIAN_MISMATCHES	PF_HQ_ERROR_RATE	MEAN_READ_LENGTH	READS_ALIGNED_IN_PAIRS	PCT_READS_ALIGNED_IN_PAIRS	BAD_CYCLES	STRAND_BALANCE	PCT_CHIMERAS	PCT_ADAPTER
FIRST_OF_PAIR	5	5	1	0	0	0	0	0	0	0	?	13	0	?	0	?	?	0
SECOND_OF_PAIR	5	5	1	0	0	0	0	0	0	0	?	13	0	?	0	?	?	0
PAIR	10	10	1	0	0	0	0	0	0	0	?	13	0	?	0	?	?	0