Source

galaxy-obo / test-data / rgClustal_testin.fasta

The default branch has multiple heads

>c_briggsae-chrII(+)/43862-46313
ATGAGCTTCCACAAAAGCATGAGCTTTCTCAGCTTCTGCCACATCAGCATTCAAATGATC
>c_remanei-Crem_Contig172(-)/123228-124941
ATGAGCCTCTACAACCGCATGATTCTTTTCAGCCTCTGCCACGTCCGCATTCAAATGCTC
>c_brenneri-Cbre_Contig60(+)/627772-630087
ATGAGCCTCCACAACAGCATGATTTTTCTCGGCTTCCGCCACATCCGCATTCAAATGATC
>c_elegans-II(+)/9706834-9708803
ATGAGCCTCTACTACAGCATGATTCTTCTCAGCTTCTGCAACGTCAGCATTCAGATGATC
>c_briggsae-chrIfooI(+)/43862-46313
CGCACAAATATGATGCACAAATCCACAACCTAAAGCATCTCCGATAACGTTGACCGAAGT
>c_remanei-Crem_Contig172foo(-)/123228-124941
AGCACAAATGTAATGAACGAATCCGCATCCCAACGCATCGCCAATCACATTCACAGATGT
>c_brenneri-Cbre_Contig60gak(+)/627772-630087
CGCACAAATGTAGTGGACAAATCCGCATCCCAAAGCGTCTCCGATAACATTTACCGAAGT
>c_elegans-II(+)more/9706834-9708803
TGCACAAATGTGATGAACGAATCCACATCCCAATGCATCACCGATCACATTGACAGATGT
>c_briggsae-chrII(+)bar/43862-46313
CCGGAGTCGATCCCTGAAT-----------------------------------------
>c_remanei-Crem_Contig172zot(-)/123228-124941
ACGAAGTCGGTCCCTATAAGGTATGATTTTATATGA----TGTACCATAAGGAAATAGTC
>c_brenneri-Cbre_Contig60fee(+)/627772-630087
ACGAAGTCGATCCCTGAAA---------TCAGATGAGCGGTTGACCA---GAGAACAACC
>c_elegans-II(+)meh/9706834-9708803
ACGAAGTCGGTCCCTGAAC--AATTATTT----TGA----TATA---GAAAGAAACGGTA