Clone wiki

enterobase-web / mcatarrhalis MLST Legacy Info RST

Protocols used for MLST of Moraxella catarrhalis

Genes

The M. catarrhalis MLST scheme uses internal fragments of the following eight house-keeping genes:

glyRS (glycyl-tRNA synthetase beta subunit)
ppa (Pyrophosphate phospho-hydrolase)
efp (elongation factor P)
fumC (fumarate hydratase)
trpE (anthranilate synthase component I)
mutY (adenine glycosylase)
adk (Adenylate kinase)
abcZ (ATP-binding protein)

PCR Amplification

The primer pairs we use for the PCR amplification of internal fragments of these genes are:

Gene Primer pair sequences Product length
glyRS

F 5'-GCACCGAAGAGTTGCCACCA-3'

R 5'-ACGCAACGGGCAAATCCACC-3'

762 bp
ppa

F 5'-AATAAAATTCTAGATGCTGGC-3'

R 5'-ACTTATTGCTCTGTCCAGCG-3'

523 bp
efp

F 5'-CTCTGATTGACAACTGGCAGG-3'

R 5'-GATATTCGCCAGTACGCG-3'

582 bp
fumC

F 5'-GGGCGGTACAGCAGTCGGCAC-3'

R 5'-CTCATCAAATTCAGCTTCAG-3'

675 bp
trpE

F 5'-TTATCCCGCATCGAAAATGG-3'

R 5'-GGTTTCATCCCATTCAGCC-3'

545 bp
mutY

F 5'-GGCAATACCATCATCAGCCG-3'

R 5'-GGTAACTGACTTTGAACGCC-3'

609 bp
adk

F 5'-GGCATTCCTCAAATCTCAAC-3'

R 5'-GATGGGCTTTATTGTCAAATG-3'

631 bp
abcZ

F 5'-ACATGCTGATGATGGTGAG-3'

R 5'-CACTGGCAAGTTCAAGCGC-3'

610 bp

An annealing temperature of 52° C is fine for all genes, except GlyRS (58° C) and adk (54° C).

Sequencing

We use the amplification primer pairs for the sequencing step except for the following genes.

glyRS: F 5'-GCACCGAAGAGTTGCCACCA-3'
glyRS: R 5'-ATATCGGCTTGACGCTGATC-3'

fumC: F 5'-GCTGTCAAAGTCGCTAAAG-3'
fumC: R 5'-CTCATCAAATTCAGCTTCAG-

mutY: F 5'-TATGCTGTGTGGGTATCTG-3'
mutY: R 5'-GGTAACTGACTTTGAACGCC-3'

Allele template

Allelic profile of M. catarrhalis MC216

glyRS (537 bp):
GTTGGCACTTTACTAAATGATCAAAATATCAGCTTTGATGATATTCATGCCTTTGCCGCACCACGCCGTTTGGCACTTACTATTAC
AGGTGTGGGCGAGTTTCAGCCTGACCGTATCGAAACTAAAAAAGGCCCAAGTGTTAAGGCAGCGTTTGATGACGCAGGTAATTTAA
CGCGTGCAGGGCAAGGATTTTTGCAAGGTTTAAATGCCACTGGGCGAAATCTTAGTGTCAAAGATTTGGGGCGTATTGCTGATAAA
AAAGGCGAGTACATCGCTTATGATTTGACCATTAAAGGCGAAAAAATCACCGATTTAATGCCAAATATCTTACAAAAAGCGCTTGA
TGATTTGCCAATTGCTAAGCGTATGCGTTCTGGCATTGATCGCCATGAGTTCATACGGCCTGTTCATTGGGTGGTTTTGATGTCAG
ATGATGTTGTAATTGAGGCGACCATTCAAGGCCATAAAACTGGCAACCAAAGCCGTGGTCATCGCTATCATTCACCTGATTTTTTT
GCCATTGATCATGCCGATCAT

ppa (393 bp):
TCAAATCATAAAATTGAGTGGAATCGTCATTTGGCATGCTTTGAGCTTGATCGTGTTGAGCCAATTGCCTTTGCCAAACCATGCAA
CTATGGCTTTATTCCCCAAACCTTAGATGAAGATGGTGATGAATTAGACGCCTTAATCATCACAGAACAGCCTTTGACGACGGGTA
TTTTTCTTAAAGCCAAAGTCATCGGGGTAATGAAATTTGTGGATGATGGCGAGGTCGACGATAAAGTCATCGTTGTTCCTGCCGAT
GATCGTAATAATGGCAACGCCTATAATAGTCTTGACGACCTACCACCACAGTTAATAAAGCAACTTGAATTTCATTTTAGTCATTA
TAAAGACTTAAAAAAACCAGGCTCAACTGTGGTTGAGGGCTTTTTTGAT

efp (414 bp):
AATGAATATGTGAAACCAGGTAAAGGTCAAGCTTTTAACCGTGTTAAGTTGCGTAATCTACGCACAGGCAAAGTGCTTGAGCAGAC
TTTTAAGTCAGGCGATTCACTTGAAGGTGCTGATGTGGTGGATGTGGAAATGAACTATCTATACAACGATGGCGAATTTTGGCATT
TTATGCACCCTGAGACTTTTGAGCAATTGCAAGCAGATAAAACCGCAATGGGTGATGCTGCACAGTGGCTAAAAGAAAATTCAAAT
GCGTTATGCACTTTGACGCTATTTAATGGTGCGCCGCTGTCGGTCACACCACCAAACTTTGTAGAGCTTGAAATCGTTGAAACTGA
CCCAGGTGTTCGCGGTGATACCTCAGGTGGTGGCGGTAAGCCTGCACGCCTTGAAACAGGTGCAACCGTG

fumC (465 bp):
GAGGCTTTGGCCGCACGAGATGCCGAAGTATTTGCTTCAGGTGCACTAAAAACACTGGCAGCAAGCCTAAATAAAATCGCCAATGA
TGTGCGTTGGCTGGCTTCAGGCCCACGCTGCGGTCTAGGTGAGCTTAGCATTCCTGAAAATGAGCCTGGTTCATCCATCATGCCTG
GTAAAGTCAATCCAACTCAGTGTGAGGCGATGACCATGGTGGTCACCCAAGTCTTTGGTAATGATACGACCATTTCTATGGCAGGG
GCTTCTGGTAATTTTGAATTAAATGTTTATATGCCTGTGATTGGATATAACTTATTGCAGTCGATTCGTCTGCTAACGGATGCGAT
CAATAGCTTTAATGAGCATTGTGCGGTAGGGATCGAACCAATTTACGAAAAAATTGACCATTATTTACATCATTCTTTGATGTTGG
TCACCGCACTCAATCGCCATATTGGCTATGAAAAT

trpE (372 bp):
TTAAATGACCAAAAAGAGATCGCAGAACATCTGATGCTCATTGATCTTGGGCGTAATGATATTGGGCGTGTCTGTGAGATTGGTTC
GGTTAAAGTGACAGATCAGATGTTCATTGAACGCTACTCGCAAGTGATGCATATCGCTAGTAATGTTGAGGGGCGTATACGCCAAG
ATGTCGATGCTTTAGATGTGTTTTGTGCGACCTTTCCAGCGGGTACTTTGTCTGGTGCGCCAAAAATCCGTGCCATGCAAATTATT
GATGAAGTTGAGCCAGTGCGTCGCACCGTTTTTGGCGGGGCGATCGGATATCTTGGCTGGCATGGCAATATGGATACTGCCATCGC
AATACGCACAGCGGTCATGAAAGATGGT

mutY (426 bp):
TTTTTTGAGCCGTTTTTGGCACGATTTGCAACCGTACAAGAGCTTGCTGTAGCAGATTGGCAAGAAGTAGCGTCTTTTTGGGCAGG
GCTTGGGTATTATGCTCGGGCAAGAAATTTACACGCAGGCGCACAGCAAGTGGCTGATTTTATTGATACTCATGGCAGGTTTCCTG
AAACGGTCAATGAGTGGCAAGCAGTCAAAGGGGTGGGGCGATCGACAGCTGGCGCAATCGTTGCGATGGGCGTTAAGAAGTTTGGC
GTCATCTGCGATGGCAATGTCAAGCGTGTACTTGCTCGCCATCGCGCGGTTTTTGGTGATGTGACAAAAAGCGCAACTGACAAAAG
GCTTTGGGAAATTGCCACCGCACTAACCCCGAAAGAGTATAGTGGACACTATGCCCAAGCGATGATGGATTTGGGTGCAACA

adk (471 bp):
CAAGCAAAAAGTGTCATGGATGCAGGTCAATTGGTTTCTGATGAGCTGATTATTAATTTGGTTAAAGAACGCTTAAAACAGCCAGA
TTGTGACAATGGTTGTATTTTTGATGGATTCCCACGCACAATCCCACAAGCCAAAGCACTGGCAGATGCTGGCATTGCCATTGACC
ATGTGATTGAAATCAGCGCCCCTGATGATGAAATCGTAAGCCGTATGTCGGGTCGCCGTGCACATTTGGCATCAGGTCGTACTTAT
CATGTGATCTATAATCCCCCAAAAACTGACGGTATTGATGATGTCACAGGCGAGGCACTGGTGCAGCGTGATGATGATAAAGAAGA
AGTGGTGCGTGATCGCTTATCGGTATATCACGCCCAAACCGCTACATTGATTAGTCATTATCAAGAAGTTGCCAAATCGGGCGAAA
ATGCCCCTGAATATCATGACTTTGATGGAACAAAATCCATC

abcZ (429 bp):
CTTGATGTGGTGATGGAGGGTGATGACAAAGTTGCCCAAGCCTTAAAAAACTATCATCAAGCCAGTGCAAAATGCGCCATGGGCGA
CAATGAAGCTTGTGATGCCATGAGCGGTCTTCAGCAAACACTCGATGAGTTAAATGGTTGGGACTTGGAGCGGCGTGCGCGTGCAT
TGATTGACAGCATGGGGTTTGACGCTGATGCTTGCTTATCAACATTATCAGGGGGTCGTAAACGCCGTGTTCTGTTAGCACAGGCT
TTGGTAACAAATCCTGATGTGCTACTTTTAGACGAGCCAACCAACCATTTAGATATTGAAAGCATCACTTGGCTTGAAAAATTTTT
ATTAAATGAACGATTAACCGTTCTTTTCATCTCACATGATCGGAAGTTTGTTGATACACTTGCCACTTATATCATCGAGCTTGAC

Updated