Clone wiki

enterobase-web / senterica MLST Legacy Info RST

Update information 03.01.2013: The primers that we currently use for medium throughput sequencing are now on this page. This procedure was described in O'Farrell et al. (2012) PLoS One 7, e48022. Transforming microbial genotyping: A robotic pipeline for genotyping bacterial strains.

Update information 26.07.2012: A description of the MLST scheme and an overview of strains of S. enterica subsp. enterica has now been published and can be downloaded as shown below. This includes an overview of 500 serovars and 138 eBGs. Achtman,M., Wain,J., Weill,F.-X., Nair,S., Zhou,Z., Sangal,V., Krauland,M.G., Hale,J.L., Harbottle,H., Uebeck,A., Dougan,J., Harrison,L.H., Brisse,S., S. enterica MLST Study Group (2012) PLoS Pathogens. 8, e1002776. Multilocus sequence typing as a replacement for serotyping in Salmonella enterica

Update information 01.02.2012: There has been a major change in the information content of the S. enterica database. Two fields are now included, eBG and Lineage, which were previously absent. eBG is an acronym for eBurstGroup, and is equivalent to ST Complex or Clonal Complex in other bacterial MLST schemes. STs were assigned to a common eBG if an ST contained 10 or more isolates or there were at least 2 STs linked by identity at 6/7 alleles (so-called Single Locus Variants). Some double locus variants STs were affiliated with an existing eBG if they contained the same serovar. The field "Lineage" indicates which isolates are in Lineage 3, which was defined by Didelot et al. (2011), in PLoS Pathogens 7: e1002191. Lineage 3 is equivalent to Clade B in prior publications by Didelot and Gordon. An assignment to Lineage 3 was performed on the basis of a BAPS analysis.

Update information 27.05.2008: The database has >2,300 entries currently and some mistaken information has been corrected in the last few weeks. New primers are being listed today for strains for which it is difficult to obtain PCR products or clean sequences. These can be combined in various combinations with the pre-existing primers. The database home is in the process of being moved to UCC, Cork and we hope to finally begin soon on a long needed update of the interface and functionality.

Update information 24.08.2005: Sylvain Brisse has developed new variants of the primers for amplification which consist of the same primers listed below except that the 5' end contains an added universal primer that is also used for sequencing. Amplification is at the same temperature of 55°. These added universal primers consist of Forwards: GTTTTCCCAGTCACGACGTTGTA and Reverse: TTGTGAGCGGATAACAATTTC. These primers have the advantage that it is possible to sequence more reactions with a common primer. Our experience has been generally positive except that it is now easier to cross contaminate across wells.

Update information: Major changes were made related to strains within the SARB collection as documented below: 18 January, 2005 Reexamination of the Selander SARB and SARA collections have required a number of changes. These changes are based on MLST of strains in the SARB collections maintained by Ken Sanderson (Univ. of Calgary) after transmission to the Danish Royal Veterinary Laboratory, Copenhagen, Howard Ochman (Univ. of Arizona) and Fidelma Boyd (Cork Univ.). They also include the results from reserotyping of several of the strains by Wolfgang Rabsch, RKI, Wernigerode. The changes reflect several sequencing mistakes in the original analysis of the Sanderson collection as well as strain mixups and contamination. The following table lists changes made on the MLST WEB site. A separate table lists all contradictions between current assignments and the supposed serotypes published in Boyd et al (1993) J. Gen. Microbiol. 139: 1125-1132.

Strain Former Name Former Number Current Name Current Number
SARB1 Agona 9 Agona 13
SARB19 Enteritidis 76 Enteritidis 77
SARB20 Emek 77 Emek 76
SARB35 Manhattan 18 Muenchen 18
SARA72 Manhattan 113 Muenchen 113
SARB44 Paratyphi B 87 Paratyphi B 110
SARB47 Paratyphi B 89 Limete 89
SARB49 Limete 89 Paratyphi C 114
SARB50 Paratyphi C 91 Unknown 91
SARB69 Typhisuis 100 6,7:c:- 100
SARB70 Typhisuis 70 Decatur 70

The following alleles have been deleted from the database: hemD5, hisD45 The following STs have been deleted from the database: ST9, 87

Protocols used for MLST of Salmonella enterica

Genes

The S. enterica MLST scheme uses internal fragments of the following seven house-keeping genes:

thrA (aspartokinase+homoserine dehydrogenase)
purE (phosphoribosylaminoimidazole carboxylas)
sucA (alpha ketoglutarate dehydrogenase)
hisD (histidinol dehydrogenase)
aroC (chorismate synthase)
hemD (uroporphyrinogen III cosynthase)
dnaN (DNA polymerase III beta subunit)

PCR Amplification

The primer pairs we use for the PCR amplification of internal fragments of these genes are:

Gene Primer pair sequences Product length

thrA

thrA

thrA

F 5'-GTCACGGTGATCGATCCGGT-3' recommended

R 5'-CACGATATTGATATTAGCCCG-3' recommended

R1 5'-GTGCGCATACCGTCGCCGAC-3' (also Seq)

852 bp

purE

purE

purE

purE

purE

F 5'-ATGTCTTCCCGCAATAATCC-3'

F1 5'-GACACCTCAAAAGCAGCGT'-3' recommended

R 5'-TCATAGCGTCCCCCGCGGATC-3'

R1 5'-CGAGAACGCAAACTTGCTTC-3'

R2 5'-AGACGGCGATACCCAGCGG-3' recommended

510 bp

sucA

sucA

sucA

sucA

F 5'-AGCACCGAAGAGAAACGCTG-3'

F1 5'-CGCGCTCAAACAGACCTAC-3' recommended

R 5'-GGTTGTTGATAACGATACGTAC-3'

R1 5'-GACGTGGAAAATCGGCGCC-3' recommended

643 bp

hisD

hisD

hisD

hisD

F 5'-GAAACGTTCCATTCCGCGCAGAC-3'

F1 5'-GAAACGTTCCATTCCGCGC-3' recommended

R 5'-CTGAACGGTCATCCGTTTCTG-3'

R1 5-GCGGATTCCGGCGACCAG-3' recommended

894 bp

aroC

aroC

F 5'-CCTGGCACCTCGCGCTATAC-3' recommended

R 5'-CCACACACGGATCGTGGCG-3' recommended

826 bp

hemD

hemD

hemD

F 5'-ATGAGTATTCTGATCACCCG-3'

F1 5'-GAAGCGTTAGTGAGCCGTCTGCG-3' recommended

R 5'-ATCAGCGACCTTAATATCTTGCCA-3' recommended

666 bp

dnaN

dnaN

dnaN

F 5'-ATGAAATTTACCGTTGAACGTGA-3'

R 5'-AATTTCTCATTCGAGAGGATTGC-3' recommended

R1 5'-CCGCGGAATTTCTCATTCGAG-3' recommended (also Seq)

833 bp

An annealing temperature of 55° C is fine for all genes.

Sequencing

Together with the recommended PCR primers above, we recommend using the following sequencing primers at 50C

aroC: aroC_sF1(GGCGTGACGACCGGCAC) and aroC_sR1 (AGCGCCATATGCGCCAC)
dnaN: dnaN_sF (CCGATTCTCGGTAACCTGCT) and dnaN_sR1 (ACGCGACGGTAATCCGGG)
hemD: hemD_sF2 (GCCTGGAGTTTTCCACTG) and hemd_sR (GACCAATAGCCGACAGCGTAG)
hisD: hisD_sF (GTCGGTCTGTATATTCCCGG) and hisD_sR (GGTAATCGCATCCACCAAATC)
purE: purE_sF1 (ACAGGAGTTTTAAGACGCATG) and purE_sR1 (GCAAACTTGCTTCATAGCG)
sucA: sucA_sF1 (CCGAAGAGAAACGCTGGATC) and sucA_sR (GGTTGTTGATAACGATACGTAC)
thrA: thrA_sF (ATCCCGGCCGATCACATGAT) and thrA_sR1 (ACCGCCAGCGGCTCCAGCA)

Our previous recommendations were to use the PCR primers for sucA, thrAR1 and dnaNR1 for sequencing as well as the other primers listed below:

thrA: sF 5'-ATCCCGGCCGATCACATGAT-3'
thrA: sR 5'-CTCCAGCAGCCCCTCTTTCAG-3'

purE: sF 5'-CGCATTATTCCGGCGCGTGT-3'
purE: sF1 5'-CGCAATAATCCGGCGCGTGT-3'
purE: sR 5'-CGCGGATCGGGATTTTCCAG-3'
purE: sR1 5'-GAACGCAAACTTGCTTCAT-3'

sucA: sF 5'-AGCACCGAAGAGAAACGCTG-3'
sucA: sR 5'-GGTTGTTGATAACGATACGTAC-3'

hisD: sF 5'-GTCGGTCTGTATATTCCCGG-3'
hisD: sR 5'-GGTAATCGCATCCACCAAATC-3'

aroC: sF 5'-GGCACCAGTATTGGCCTGCT-3'
aroC: sR 5'-CATATGCGCCACAATGTGTTG-3'

hemD: sF 5'-GTGGCCTGGAGTTTTCCACT-3'
hemD: sF1 5'-ATTCTGATCACCCGCCCCTC-3'
hemD: sR 5'-GACCAATAGCCGACAGCGTAG-3'

dnaN: sF 5'-CCGATTCTCGGTAACCTGCT-3'
dnaN: sR 5'-CCATCCACCAGCTTCGAGGT-3'

Allele template

Allelic profile of S. typhi strain CT18.

thrA (501 bp):
GTGCTGGGCCGTAATGGTTCCGACTATTCCGCCGCCGTGCTGGCCGCCTGTTTACGCGCTGACTGCTGTGAAATCTGGACTGACGT
CGATGGCGTGTATACCTGTGACCCGCGCCAGGTGCCGGACGCCAGGCTGTTGAAATCGATGTCCTACCAGGAAGCGATGGAGCTCT
CTTACTTCGGCGCTAAAGTCCTTCACCCTCGCACCATAACGCCTATCGCCCAGTTCCAGATCCCCTGTCTGATTAAAAATACCGGC
AATCCGCAGGCGCCAGGAACGCTGATCGGCGCGTCCAGCGACGATGATAATCTGCCGGTTAAAGGGATCTCTAACCTTAACAACAT
GGCGATGTTTAGCGTCTCCGGCCCGGGAATGAAAGGGATGATTGGGATGGCGGCGCGTGTTTTCGCCGCCATGTCTCGCGCCGGGA
TCTCGGTGGTGCTCATTACCCAGTCCTCCTCTGAGTACAGCATCAGCTTCTGTGTGCCGCAGAGTGACTGC

purE (399 bp):
AGCGACTGGGCTACCATGCAATTCGCCGCCGAAATTTTTGAAATTCTGGATGTCCCGCACCATGTAGAAGTGGTTTCCGCCCATCG
CACCCCCGATAAACTGTTCAGCTTCGCCGAAACGGCGGAAGAGAACGGATATCAAGTGATTATTGCCGGCGCGGGCGGCGCGGCAC
ACCTGCCGGGAATGATTGCGGCAAAAACGCTGGTCCCGGTACTCGGCGTGCCGGTACAAAGCGCTGCGCTCAGCGGCGTGGATAGC
CTCTACTCCATCGTGCAGATGCCGCGCGGCATTCCGGTGGGTACGCTGGCGATCGGTAAAGCCGGGGCGGCGAACGCCGCACTGCT
GGCAGCGCAAATTTTGGCTACGCATGATAGCGCGCTGCATCGGCGCATCGCCGAC

sucA (501 bp):
AAACGCTTCCTGAACGAACTGACCGCCGCTGAAGGGCTGGAACGTTATCTGGGCGCCAAATTCCCGGGTGCGAAACGTTTCTCGCT
CGAGGGGGGAGATGCGCTGATACCTATGCTGAAAGAGATGGTTCGCCATGCGGGTAACAGCGGCACTCGCGAAGTGGTGCTGGGGA
TGGCGCACCGCGGTCGTCTGAACGTGCTGATCAACGTACTGGGTAAAAAACCGCAGGATCTGTTCGACGAGTTTGCCGGTAAACAT
AAAGAACATCTGGGTACCGGCGACGTGAAGTATCACATGGGCTTCTCGTCAGATATCGAAACTGAAGGCGGTCTGGTTCACCTGGC
GCTGGCGTTTAACCCATCGCATCTGGAAATTGTGAGCCCGGTGGTGATGGGCTCCGTGCGCGCCCGTCTGGACCGACTGGACGAAC
CGAGCAGTAATAAAGTGCTGCCGATCACTATTCACGGCGACGCCGCGGTGACCGGCCAGGGCGTGGTTCAG

hisD (501 bp):
ATTGCGGGATGCCAGAAGGTGGTTCTGTGCTCGCCGCCACCCATCGCTGATGAAATCCTCTATGCGGCGCAACTGTGTGGCGTGCA
GGAAATCTTTAACGTCGGCGGCGCGCAGGCGATTGCCGCTCTGGCCTTCGGCAGCGAGTCCGTACCGAAAGTGGATAAAATTTTTG
GCCCCGGCAACGCCTTTGTAACCGAAGCCAAGCGTCAGGTCAGCCAGCGTCTCGACGGCGCGGCTATCGATATGCCAGCCGGGCCG
TCTGAAGTGCTGGTGATCGCCGACAGCGGCGCAACACCGGATTTCGTCGCTTCTGACCTGCTCTCCCAGGCTGAGCACGGCCCGGA
TTCCCAGGTGATCCTGCTGACGCCGGATGCTGACATTGCCCGCAAGGTGGCGGAGGCGGTAGAACGTCAACTGGCGGAACTGCCGC
GCGCGGGCACCGCCCGGCAGGCCCTGAGCGCCAGTCGTCTGATTGTGACCAAAGATTTAGCGCAGTGCGTC

aroC (501 bp):
GTTTTTCGCCCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGCGGCGGTGGACGTTCTTCCGCGCG
TGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACTTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGA
CCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTCTTTTGCCCCGATGCGGACAAACTT
GACGCGCTGGACGAACTGATGCGCGCGCTGAAAAAAGAGGGTGACTCCATCGGCGCGAAAGTGACGGTGATGGCGAGCGGCGTGCC
GGCAGGGCTTGGCGAACCGGTATTTGACCGACTGGATGCGGACATCGCCCATGCGCTGATGAGCATCAATGCGGTGAAAGGCGTGG
AGATCGGCGAAGGATTTAACGTGGTGGCGCTGCGCGGCAGCCAGAATCGCGATGAAATCACGGCGCAGGGT

hemD (432 bp):
GCAACGCTGACGGAAAACGATCTGGTTTTTGCCCTTTCACAGCACTCCGTCGCCTTTGCTCACGCCCAGCTCCAGCGGGATGGACG
AAACTGGCCTGCGTCGCCGCGCTATTTCTCGATTGGCCGCACCACGGCGCTCGCCCTTCATACCGTTAGCGGGTTCGATATTCGTT
ATCCATTGGATCGGGAAATCAGCGAAGCCTTGCTACAATTACCTGAATTACAAAATATTGCGGGCAAACGCGCGCTGATTTTGCGT
GGCAATGGCGGCCGCGAACTGCTGGGCGAAACCCTGACAGTTCGCGGAGCCGAAGTCAGTTTTTGTGAATGTTATCAACGATGTGC
GAAACATTACGATGGCGCGGAAGAAGCGATGCGCTGGCATACTCGCGGCGTAACAACGCTTGTTGTTACCAGCGGCGAGATGTTGC
AA

dnaN (501 bp):
ATGGAGATGGTCGCGCGCGTTACGCTTTCTCAGCCGCATGAGCCAGGCGCCACTACCGTGCCGGCGCGGAAATTCTTTGATATCTG
CCGCGGCCTGCCGGAGGGCGCGGAGATTGCCGTTCAGTTGGAAGGCGATCGGATGCTGGTGCGTTCTGGCCGTAGCCGCTTCTCGC
TGTCTACGCTGCCTGCCGCCGATTTCCCGAATCTTGACGACTGGCAAAGCGAAGTTGAATTTACGCTGCCGCAGGCCACGATGAAG
CGCCTGATTGAAGCGACCCAGTTTTCGATGGCCCATCAGGATGTGCGCTACTACTTAAACGGTATGCTGTTTGAAACGGAAGGTAG
CGAACTGCGCACTGTTGCGACCGACGGCCACCGTCTGGCGGTGTGCTCAATGCCGCTGGAGGCGTCTTTACCTAGCCACTCGGTGA
TTGTGCCGCGTAAAGGCGTGATTGAACTGATGCGTATGCTCGACGGTGGCGAAAACCCGCTGCGCGTGCAG

Updated