Clone wiki

enterobase-web / yersinia MLST Legacy Info RST

Protocols used for MLST of Yersinia pseudotuberculosis

Genes

The Y. pseudotuberculosis MLST scheme uses internal fragments of the following seven house-keeping genes:

adk (adenylate kinase)
argA (N-acetylglutamate synthase)
aroA (3-phosphoshikimate-1-carboxylvinyltransferase)
glnA (glutamine synthase)
thrA (aspartokinase I/homoserine dehydrogenase I)
tmk (thymidylate kinase)
trpE (anthranilate synthase component I)

PCR Amplification

The primer pairs we use for the PCR amplification of internal fragments of these genes are:

Gene Primer pair sequences Product length
adk

P1 F 5'-ATGCGTATCATTCTGCTGGG-3'

P2 R 5'-CCGAGAATAGTCGCCAGTTC-3'

641 bp
argA

P1 F 5'-GGATTTCGCCACTCAGTTCC-3'

P2 R 5'-ATCAGTCACCCCTTGTGATG-3'

615 bp
aroA

P3 F 5'-AGCGGCCAATTGGCCATTTG-3'

P4 R 5'-CACATCGCCATACGGTGGTC-3'

802 bp
glnA

P1 F 5'-GCTGACTTCTTCGAAGAAGG-3'

P2 R 5'-GACATATGGCAGTGCATACC-3'

701 bp
thrA

P3 F 5'-CGTCTTTGCGGTGATGTCG-3'

P2 R 5'-GTTGGTGTCATACAAGAATTTACG-3'

823 bp
tmk

P3 F 5'-TATTGAAGGGCTTGAAGGGG-3'

P4 R 5'-TGATTGGTCAGCCACTGAGC-3'

606 bp
trpE

P3 F 5'-CACCAGTTACAACAAGCGCC-3'

P4 R 5'-GTATCCAAATCACCGTGAGC-3'

743 bp

An annealing temperature of 55° C is fine for all genes.

Sequencing

adk_S1: F 5'-TGGAGAAATACGGCATTCCG-3'
adk_S2: R 5'-ACATTACGGGTTCCGTCCAG-3'

argA_S3: F 5'-CAAGACATTTGTTGTCATGC-3'
argA_S4: R 5'-ATGGCTAACTGAGTTGCAAC-3'

aroA_S3: F 5'-TGCACAGATCGATTATCTGG-3'
aroA_S2: R 5'-ATGGTCATTGCAGCATCAGG-3'

glnA_S1: F 5'-TTTGATGGCTCCTCGATTGGTG-3'
glnA_S2: R 5'-TTGGTCATGGTATTGAAGCG-3'

thrA_S1: F 5'-GATGTGATGGAACATCTGGC-3'
thrA_S2: R 5'-GTCACCACATGGAAGCCATC-3'

tmk_S5: F 5'-GGCCCAAGGGATTAACGATAT-3'
tmk_S2: R 5'-AATGGGTTGGGAGGCATCAAT-3'

trpE_S1: F 5'-CCAGAGATGGCGTTACAGTG-3'
trpE_S4: R 5'-TAGCCCACTGCACCGCCGTA-3'

Allele template

Allelic profile of Y. pseudotuberculosis strain SP93422.

adk (389 bp):
AAAGCAGGTTCTGAGTTAGGTCTGAAAGCAAAAGAAATTATGGATGCGGGCAAGTTGGTGACTGATGAGTTAGTTATCGCAT
TAGTCAAAGAACGTATCACACAGGAAGATTGCCGCGATGGTTTTCTGTTAGACGGGTTCCCGCGTACCATTCCTCAGGCAGAT
GCCATGAAAGAAGCCGGTATCAAAGTTGATTATGTGCTGGAGTTTGATGTTCCAGACGAGCTGATTGTTGAGCGCATTGTCGG
CCGTCGGGTACATGCTGCTTCAGGCCGTGTTTATCACGTTAAATTCAACCCACCTAAAGTTGAAGATAAAGATGATGTTACCG
GTGAAGAGCTGACTATTCGTAAAGATGATCAGGAAGCGACTGTCCGTAAGCGTCTTAT

argA (361 bp):
CTAGTATCGTCAACGATATAGGCTTATTACATAGCCTTGGGATCAGATTAGTCGTGGTATACGGTGCCCGACCACAGATTGAC
AGTAATCTGGCAGATCATAACTACGAACCTATTTATCATAAACATACCCGAGTGACTGACGCCCGGACTCTGGAGATGGTCA
AGCAAGCGGCCGGTTTATTACAACTGGATATCACGGCCAGGCTTTCAATGAGTTTGAACAACACCCCACTGCAAGGTGCTCAT
ATCAACGTAGTTAGCGGTAACTTTATCATTGCTCAACCGCTAGGTGTGGATGATGGTGTTGATTATTGCCATAGCGGGCGTATC
CGGCGCATTGATGAAGAAGCTATTCATCG

aroA (357 bp):
TTGATGGGCGTGTCTCTAGCCAGTTCCTGACTGCTTTATTGATGACCGCCCCGCTGGCGGAGCAAGATACGACTATTCGGATT
TGGGTGATCTGGTTTCCAAACCTTATATCGATATTACTCTGCACTTGATGAAAGCATTTGGTATTGACGTGGGGCATGAGAAC
TACCAAATTTTCCACATCAAAGGGGGTCAGACCTACCGCTCACCAGGGACTTATTTGGTTGAGGGCGATGCCTCGTCGGCTTC
CTACTTCTTAGCGGCTGCGGCTATTAAGGGGGGAACAGTGCGTGTCACTGGTATTGGCAAGAAAAGTGTACAGGGCGACACT
AAATTTGCCGATGTGTTGGAAAAAA

glnA (338 bp):
CACTGATTATCCGTTGTGACATTCTTGAGCCAGGCACCATGCAGGGCTATGACCGCGATCCACGTTCTATCTCCAAACGTG
TGAAGACTTCCTGAAATCTTCAGGTATCGCTGATACCGTGTTGTTCGGGCCAGAACCAGAATTCTTCCTGTTTGACGATATC
CGTTTTGGTAGCAGCATCAATGGGTCACACGTATCCATCGATGACGTCGAAGGCGCATGGAACTCCAGCACCAAATACGA
AGGCGGCAACAAAGGCCACCGTCCTGCAGTAAAAGGCGGTTACTTCCCTGTTCCTCCGGTCGACTCTGCACAAGACCTCC
GTTCTGCCATGTGT

thrA (342 bp):
TCAATATTATTGCTATCGCTCAAGGCTCGTCTGAGCGCTCTATTTCTGTGGTTGTCAATAATGATGCGGTCACTACCGGGGTGC
AGTTTGCCACCAGATGCTGTTTAACACGGATCAAGTCATTGAGGTGTTTGTCATTGGCGTGGGTGGTGTGGGGGGCGCATTAA
TCGAACAAATCTATCGCCAGCAACCGTGGTTGAAACAGCGTCATATCGATTTACGTGTTTGTGGTATCGCGAATTCCAAAGCC
ATGTTGACCAACGTGCATGGCATTGCATTAGATAACTGGCGTCAGGAACTGGCTGAAGTTCAGGAGCCGTTTAACCTGAGCC
GCTTGATCC

tmk (375 bp):
AAAACTGCGTGATTTGATTAAGCAAGGTATTGACGGTGAGGTCCTGACGGATAAAGCCGAGGTATTAATGCTGTATGCCG
CCAGGGTGCAATTAGTAGAAAATGTCATCAAGCCAGCACTGGCGCGTGGCAGTTGGGTTGTGGGTGACCGCCATGATTTG
TCATCACAGGCATATCAGGGCGGGGGGCGAGGGATTGACAGCCAACTGATGGCCTCGTTACGTGACACGGTGTTAGGCG
AATTCCGGCCAGACCTGACCTTATATTTGGATCTGCCACCGGCTGTGGGCTTGGCGCGCGCGCGCGCGCGCGGTGAATTGG
ACCGTATCGAACAAGAGTCACTGGCGTTTTTTGAGCGAACCCGCGCACGTTACCT

trpE (465 bp):
CCATCCCGCCGTTTTACGCTGCCCTGCCCATCACCGCTGGCGGCCTATCAGACACTGAAAGACCATAATCCCAGCCCCTAC
ATGTTTTTCATGCAAGACAATGATTTTTCTCTGTTTGGCGCATCACCTGAAAGCGCACTGAAATACGATGCCAGCAACCGT
CAAATTGAGATTTACCCGATTGCGGGTACTCGTCCACGCGGTCGTCGTCCTAATGGAGAACTCGATCGTGATTTAGACAG
CCGTATCGAGTTGGAAATGCGTACTGACCATAAAGAGATGGCAGAACATTTAATGTTGGTGGATCTGGCTCGTAACGATC
TGGCACGTATTTGCGAACCCGGTAGCCGCTATGTTGCAGATTTAACCAAAGTTGACCGTTACTCTTTTGTCATGCATCTGG
TGTCCCGCGTGATTGGCACTCTGCGTCAAGATTTAGATGTGCTGCATGCTTATCAAGCGTGT

Updated