Source

galaxy-central / test-data / fasta_collapser1.fasta

Full commit
>1
TGTATTTACAATGACTAGAAA
>2
ATTGCTGCTCGGATGGTCCGGCTGTGCACAC
>3
AGTACAAGGACATGC
>4
ATTGCTGCTCGGATGGTCCGGCTGTGCACAC
>5
AGTACAAGGACATGC
>6
ATTGCTGCTCGGATGGTCCGGCTGTGCACAC
>7
AGTACAAGGACATGC
>8
AGTACAAGGACATGC
>9
ATTGCTGCTCGGATGGTCCGGCTGTGCACAC
>10
AGTACAAGGACATGC
>11
AGTACAAGGACATGC
>12
ATTGCTGCTCGGATGGTCCGGCTGTGCACAC
>13
CGATTGCCGAAGTCTACCA
>14
AGTACAAGGACATGC
>15
CCTTGTAGTGGATTCTGATGA
>16
AGTACAAGGACATGC
>17
AGTACAAGGACATGC
>18
ATTGCTGCTCGGATGGTCCGGCTGTGCACAC
>19
AGTACAAGGACATGC
>20
ATTGCTGCTCGGATGGTCCGGCTGTGCACAC
>21
AGTACAAGGACATGC
>22
AGTACAAGGACATGC
>23
CTGCTGCGATCGGTGTGC
>24
AGTACAAGGACATGC
>25
ACCATTCGAGCATAC
>26
AGTACAAGGACATGC
>27
TCAAATTCTAGATTTTTACGG
>28
AGTACAAGGACATGC
>29
TGATTTCCAGAGCCAAT
>30
ATTGCTGCTCGGATGGTCCGGCTGTGCACAC
>31
TTACCTCACGATATTGTAATA
>32
ATGACTTCATCGTCCACCCTTTAGAACT
>33
ATTGCTGCTCGGATGGTCCGGCTGTGCACAC
>34
TTCAACGCCGCCGTGAAC
>35
ATTGCTGCTCGGATGGTCCGGCTGTGCACAC
>36
CTGCTGCGATCGGTGTGC
>37
ATTGCTGCTCGGATGGTCCGGCTGTGCACAC
>38
TTCAACGCCGCCGTGAAC
>39
TTCAACGCCGCCGTGAAC
>40
CTGCTGCGATCGGTGTGC
>41
TTCAACGCCGCCGTGAAC
>42
TTCAACGCCGCCGTGAAC