galaxy-central / tools / fastq / fastq_paired_end_deinterlacer.xml

<tool id="fastq_paired_end_deinterlacer" name="FASTQ de-interlacer" version="1.1">
  <description>on paired end reads</description>
  <command interpreter="python">fastq_paired_end_deinterlacer.py '$input_file' '${input_file.extension[len( 'fastq' ):]}' '$output1_pairs_file' '$output2_pairs_file' '$output1_singles_file' '$output2_singles_file'</command>
  <inputs>
    <param name="input_file" type="data" format="fastqsanger,fastqcssanger" label="FASTQ reads" />
  </inputs>
  <outputs>
    <data name="output1_pairs_file" format="input" label="FASTQ de-interlacer left mates from data ${input_file.hid}" />
    <data name="output2_pairs_file" format="input" label="FASTQ de-interlacer right mates from data ${input_file.hid}"/>
    <data name="output1_singles_file" format="input" label="FASTQ de-interlacer left singles from data ${input_file.hid}"/>
    <data name="output2_singles_file" format="input" label="FASTQ de-interlacer right singles from data ${input_file.hid}"/>
  </outputs>
  <tests>
    <test>
      <param name="input_file" value="paired_end_merged.fastqsanger" ftype="fastqsanger" />
      <output name="output1_pairs_file" file="paired_end_1.fastqsanger" />
      <output name="output2_pairs_file" file="paired_end_2.fastqsanger" />
      <output name="output1_singles_file" file="paired_end_1_singles.fastqsanger" />
      <output name="output2_singles_file" file="paired_end_2_singles.fastqsanger" />
    </test>
    <test>
      <param name="input_file" value="paired_end_merged_errors.fastqsanger" ftype="fastqsanger" />
      <output name="output1_pairs_file" file="paired_end_1_cleaned.fastqsanger" />
      <output name="output2_pairs_file" file="paired_end_2_cleaned.fastqsanger" />
      <output name="output1_singles_file" file="paired_end_1_cleaned_singles.fastqsanger" />
      <output name="output2_singles_file" file="paired_end_2_cleaned_singles.fastqsanger" />
    </test>
  </tests>
  <help>
**What it does**

De-interlaces a single fastq dataset representing paired-end run into two fastq datasets containing only the first or second mate read. Reads without mate are saved in separate output files.

Sequence identifiers for paired-end reads must follow the /1 and /2 convention.

-----

**Input**

A multiple-fastq file containing paired-end reads, for example::

    @1539:931/1
    ACTTCCCGCGCGTGAAGGCGCCGGCAAACGAGGCTCGGGAAGGGGCTCCCG
    +1539:931/1
    BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
    @1539:931/2
    CGCCATTCCGAATCGTAGTTGTCGGCGTCTTCCAGTGCGGCAAGGCATCGT
    +1539:931/2
    WNUUZ\P^`BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB

-----

**Output**

Multi-fastq file with left-hand mate only::

    @1539:931/1
    ACTTCCCGCGCGTGAAGGCGCCGGCAAACGAGGCTCGGGAAGGGGCTCCCG
    +1539:931/1
    BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB

Multi-fastq file with right-hand mate only::

    @1539:931/2
    CGCCATTCCGAATCGTAGTTGTCGGCGTCTTCCAGTGCGGCAAGGCATCGT
    +1539:931/2
    WNUUZ\P^`BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB

  </help>
</tool>
Tip: Filter by directory path e.g. /media app.js to search for public/media/app.js.
Tip: Use camelCasing e.g. ProjME to search for ProjectModifiedEvent.java.
Tip: Filter by extension type e.g. /repo .js to search for all .js files in the /repo directory.
Tip: Separate your search with spaces e.g. /ssh pom.xml to search for src/ssh/pom.xml.
Tip: Use ↑ and ↓ arrow keys to navigate and return to view the file.
Tip: You can also navigate files with Ctrl+j (next) and Ctrl+k (previous) and view the file with Ctrl+o.
Tip: You can also navigate files with Alt+j (next) and Alt+k (previous) and view the file with Alt+o.