HTTPS SSH

km : a software for RNA-seq investigation using k-mer decomposition

Introduction

This tool was developed to identify and quantify the occurence of single nucleotide variants, insertions, deletions and duplications in RNA-seq data. Contrary to most tools that try to report all variants in a complete genome, here we instead propose to focus the analysis on small regions of interest.

Given a reference sequence of interest (typically a few hundred base pairs) around a known or suspected mutation in a gene of interest, all possible sequences that can be be created between the two end k-mers according to the sequenced reads will be reported. A ratio of variant allele vs WT will be computed for each possible sequence constructed.

Requirements

A jellyfish database of quality and adapter trimmed sequences must first be prepared using the following script:

usage: prepare [-h] [-z] [-m MAX_RAM] outfile [infiles [infiles ...]]
prepare: error: too few arguments

./prepare -z -m 16 sample.jf fastq/*.gz

Usage

usage: find_mutation [-h] [-c [COUNT]] [-p [RATIO]] [-g] [-v]
                     [reference_fn [reference_fn ...]] jellyfish_fn

./find_mutation query_examples/NPM1.fa sample.jf

Here we are looking for a common 4-bp duplication that occurs in some leukemias, and that is especially troublesome to detect since it occurs a few base pairs from the start of the last exon. Most standard mapping techniques will miss this variant. Running the find_mutation command takes a few seconds and returns an output similar to this:

Database    Query   Type    Variant name    Ratio   Expression  Sequence    Reference ratio Reference expression    Reference sequence  Info
sample.jf   NPM1    Insertion   93:/TCTG:93 0.528   9020.0  CCAAGAGGCTATTCAAGATCTCTGTCTGGCAGTGGAGGAAGTCTCTT 0.472   8076.8  CCAAGAGGCTATTCAAGATCTCTGGCAGTGGAGGAAGTCTCTT cluster 1 n=1

real    0m6.712s
user    0m0.203s
sys 0m0.312s

which shows that a TCTG insertion was found at position 93 of the refence sequence.

Output description

Each line represents a path that was constructed from the reference sequence.

  • Database: name of the Jellyfish kmer table queried
  • Query: name of the reference sequence examined
  • Type: type of mutation found (Insertion, Deletion or Substitution). A Reference type used to identify path without mutation
  • Variant name: A description of the modification in the format start_position:deleted_bases/inserted_bases:end_position
  • Ratio: estimated ratio for the mutated allele represented by this path
  • Expression: estimated expression level for the mutated allele (coverage)
  • Sequence: sequence of the mutated path
  • Reference ratio: estimated ratio of the reference allele
  • Reference expression: estimated expression level for the reference
  • Reference sequence: reference sequence used
  • Info: supplementary information regarding the quantification method.
    .. vs_ref means that each alternate path is compared in expression with the whole reference sequence.
    ..
    cluster indicates that all alternate path in a subregion extending by k bases on each side of all overlapping mutations are considered at once to evaluate the expression of each

Using the -g argument, one can also obtain a coverage graph for the two variants, for example:

figure_1.png

To do:

  • Complete this list.