Parse CDR3 from IgBLAST v.1.5.0+
The April 25, 2016 release of IgBLAST v1.5.0 added a CDR3 annotation to the output (mouse example below with surrounding output for context). It would be nice to extract this information. This might be achieved with the addition of an optional argument so as to not break compatibility with older IgBLAST versions?
# V-(D)-J junction details based on top germline gene matches (V end, V-D junction, D region, D-J junction, J start). Note that possible overlapping nucleotides at VDJ junction (i.e, nucleotides that could be assigned to either rearranging gene) are indicated in parentheses (i.e., (TACT)) but are not included under the V, D, or J gene itself
CTGTG TGAGAGATCGGGGCTATGATAGTAGTGG TTATTAC GGAAATCTTGACTG CTGGG
# Sub-region sequence details (nucleotide sequence, translation)
CDR3 GTGAGAGATCGGGGCTATGATAGTAGTGGTTATTACGGAAATCTTGACTGC VRDRGYDSSGYYGNLDC
# Alignment summary between query and top germline V gene hit (from, to, length, matches, mismatches, gaps, percent identity)
...
Comments (7)
-
-
-
assigned issue to
-
assigned issue to
-
reporter Hi Jason,
Much appreciated! One use of this additional argument is for parsing IgBLAST results generated with the kabat domain system, although I agree that the MakeDB
CDR3_IMGT
should be equivalent to the IgBLASTCDR3
when using the IMGT domain system and the--regions
argument.I could work on a pull request?
Best, Derek
-
Certainly, @dcroote! We're quite happy to accept pull requests.
I can also take a crack at it, if you'd prefer, but not until sometime next week.
-
Hey, @dcroote. I merged your pull request, updated the docs accordingly, and made minor stylistic tweaks:
- Renamed argument to
--cdr3
, just because it's shorter. - Renamed columns to
CDR3_IGBLAST_NT
andCDR3_IGBLAST_AA
, just so they look like theCDR3_IMGT
column.
I ran the same raw data though IgBLAST 1.4, 1.5 and 1.6 and tested. Looks good! Thanks again.
- Renamed argument to
-
- changed status to resolved
Pull request merged, tested, and added to docs in d1de2e3.
-
reporter Great, thanks!
- Log in to comment
Hi @dcroote, this should be pretty simple to add. Though, MakeDb does already have a
--regions
argument that will add a column containing the CDR3 region, as defined by IMGT.We could certainly add an extra argument to add the IgBLAST CDR3. Assuming they are different in some way.
I'll take a look at it.