- changed status to open
Inconsistency in novel allele between genotype plot and evidence plot
I’ve encountered this a few times by now and always found it to be very confusing. The novel evidence plot would show evidence for, say, IGHV1-69*13 Position 244 G-> A. But then this “novel” allele would not show up at all in the genotype plot, which indicates a IGHV1-69*14_G54A.
Upon investigation, shown below, where the detected polymorphism is indicated in capitalized letter at the corresponding position, IGHV1-69*13_G244A and IGHV1-69*14_G54A are identical. This itself is fine, but it is very confusing to show evidence for one thing and call it another name for genotyping. The seeming mismatch almost looks like a bug if one does not dig further below the surface!
>IGHV1-69*13_G244A
caggtccagctggtgcagtctggggct...gaggtgaagaagcctgggtcctcagtgaag
gtctcctgcaaggcttctggaggcaccttc............agcagctatgctatcagc
tgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatc...
...tttggtacagcaaactacgcacagaagttccag...ggcagagtcacgattaccgcg
gacAaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggcc
gtgtattactgtgcgagaga
>IGHV1-69*14_G54A
caggtccagctggtgcagtctggggct...gaggtgaagaagcctgggtcctcAgtgaag
gtctcctgcaaggcttctggaggcaccttc............agcagctatgctatcagc
tgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatc...
...tttggtacagcaaactacgcacagaagttccag...ggcagagtcacgattaccgcg
gacaaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggcc
gtgtattactgtgcgagaga
Comments (6)
-
-
reporter Sorry for not having provided a minimal reproducible example – I realized that it’d probably be hard to diagnose without one. I uploaded one here on Box: https://yale.box.com/s/aznsi4em6iscjuze6gugnwbbe0xlem31
-
reporter Notice that the novel evidence plot shows IGHV1-69*13_G244A, which does not show up in the genotype plot, which shows IGHV1-69*14_G54A instead.
-
- changed milestone to next release
-
Thanks @Julian Zhou Yes, it is confusing. I have added a check to add a comment in the ‘note’ section of
findNovelAlleles
if duplicatednovel_imgt
exist. It outputs a message like this:> novelDf[grepl("Same as", novelDf$note),c("polymorphism_call", "note")] polymorphism_call 13 IGHV1-69*13_G244A 14 IGHV1-69*14_G54A 33 IGHV3-30*19_C170G_A171G 34 IGHV3-30*19_C170G_A171G 36 IGHV3-33*01_T201C_C288T 37 IGHV3-33*01_T201C_C288T note 13 Novel allele found!. Same as: IGHV1-69*14_G54A 14 Novel allele found!. Same as: IGHV1-69*13_G244A 33 Novel allele found!. Same as: IGHV3-33*01_T201C_C288T 34 Novel allele found!. Same as: IGHV3-33*01_T201C_C288T 36 Novel allele found!. Same as: IGHV3-30*19_C170G_A171G 37 Novel allele found!. Same as: IGHV3-30*19_C170G_A171G
Next I will see what can be done with
inferGenotype
… -
- removed milestone
- Log in to comment