Inconsistency in novel allele between genotype plot and evidence plot

[Julian Zhou]

I’ve encountered this a few times by now and always found it to be very confusing. The novel evidence plot would show evidence for, say, IGHV1-69*13 Position 244 G-> A. But then this “novel” allele would not show up at all in the genotype plot, which indicates a IGHV1-69*14_G54A.

Upon investigation, shown below, where the detected polymorphism is indicated in capitalized letter at the corresponding position, IGHV1-69*13_G244A and IGHV1-69*14_G54A are identical. This itself is fine, but it is very confusing to show evidence for one thing and call it another name for genotyping. The seeming mismatch almost looks like a bug if one does not dig further below the surface!

>IGHV1-69*13_G244A
caggtccagctggtgcagtctggggct...gaggtgaagaagcctgggtcctcagtgaag
gtctcctgcaaggcttctggaggcaccttc............agcagctatgctatcagc
tgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatc...
...tttggtacagcaaactacgcacagaagttccag...ggcagagtcacgattaccgcg
gacAaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggcc
gtgtattactgtgcgagaga
>IGHV1-69*14_G54A
caggtccagctggtgcagtctggggct...gaggtgaagaagcctgggtcctcAgtgaag
gtctcctgcaaggcttctggaggcaccttc............agcagctatgctatcagc
tgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatc...
...tttggtacagcaaactacgcacagaagttccag...ggcagagtcacgattaccgcg
gacaaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggcc
gtgtattactgtgcgagaga

[Julian Zhou]

Sorry for not having provided a minimal reproducible example – I realized that it’d probably be hard to diagnose without one. I uploaded one here on Box: https://yale.box.com/s/aznsi4em6iscjuze6gugnwbbe0xlem31

[Julian Zhou]

Notice that the novel evidence plot shows IGHV1-69*13_G244A, which does not show up in the genotype plot, which shows IGHV1-69*14_G54A instead.

[ssnn]

Thanks @Julian Zhou Yes, it is confusing. I have added a check to add a comment in the ‘note’ section of findNovelAlleles if duplicated novel_imgt exist. It outputs a message like this:

> novelDf[grepl("Same as", novelDf$note),c("polymorphism_call", "note")]
         polymorphism_call
13       IGHV1-69*13_G244A
14        IGHV1-69*14_G54A
33 IGHV3-30*19_C170G_A171G
34 IGHV3-30*19_C170G_A171G
36 IGHV3-33*01_T201C_C288T
37 IGHV3-33*01_T201C_C288T
                                                    note
13        Novel allele found!. Same as: IGHV1-69*14_G54A
14       Novel allele found!. Same as: IGHV1-69*13_G244A
33 Novel allele found!. Same as: IGHV3-33*01_T201C_C288T
34 Novel allele found!. Same as: IGHV3-33*01_T201C_C288T
36 Novel allele found!. Same as: IGHV3-30*19_C170G_A171G
37 Novel allele found!. Same as: IGHV3-30*19_C170G_A171G

Next I will see what can be done with inferGenotype…