Inconsistency in novel allele between genotype plot and evidence plot

Issue #31 open
Julian Zhou created an issue

I’ve encountered this a few times by now and always found it to be very confusing. The novel evidence plot would show evidence for, say, IGHV1-69*13 Position 244 G-> A. But then this “novel” allele would not show up at all in the genotype plot, which indicates a IGHV1-69*14_G54A.

Upon investigation, shown below, where the detected polymorphism is indicated in capitalized letter at the corresponding position, IGHV1-69*13_G244A and IGHV1-69*14_G54A are identical. This itself is fine, but it is very confusing to show evidence for one thing and call it another name for genotyping. The seeming mismatch almost looks like a bug if one does not dig further below the surface!

>IGHV1-69*13_G244A
caggtccagctggtgcagtctggggct...gaggtgaagaagcctgggtcctcagtgaag
gtctcctgcaaggcttctggaggcaccttc............agcagctatgctatcagc
tgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatc...
...tttggtacagcaaactacgcacagaagttccag...ggcagagtcacgattaccgcg
gacAaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggcc
gtgtattactgtgcgagaga
>IGHV1-69*14_G54A
caggtccagctggtgcagtctggggct...gaggtgaagaagcctgggtcctcAgtgaag
gtctcctgcaaggcttctggaggcaccttc............agcagctatgctatcagc
tgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatc...
...tttggtacagcaaactacgcacagaagttccag...ggcagagtcacgattaccgcg
gacaaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggcc
gtgtattactgtgcgagaga

Comments (5)

  1. Julian Zhou reporter

    Notice that the novel evidence plot shows IGHV1-69*13_G244A, which does not show up in the genotype plot, which shows IGHV1-69*14_G54A instead.

  2. ssnn

    Thanks @Julian Zhou Yes, it is confusing. I have added a check to add a comment in the ‘note’ section of findNovelAlleles if duplicated novel_imgt exist. It outputs a message like this:

    > novelDf[grepl("Same as", novelDf$note),c("polymorphism_call", "note")]
             polymorphism_call
    13       IGHV1-69*13_G244A
    14        IGHV1-69*14_G54A
    33 IGHV3-30*19_C170G_A171G
    34 IGHV3-30*19_C170G_A171G
    36 IGHV3-33*01_T201C_C288T
    37 IGHV3-33*01_T201C_C288T
                                                        note
    13        Novel allele found!. Same as: IGHV1-69*14_G54A
    14       Novel allele found!. Same as: IGHV1-69*13_G244A
    33 Novel allele found!. Same as: IGHV3-33*01_T201C_C288T
    34 Novel allele found!. Same as: IGHV3-33*01_T201C_C288T
    36 Novel allele found!. Same as: IGHV3-30*19_C170G_A171G
    37 Novel allele found!. Same as: IGHV3-30*19_C170G_A171G
    

    Next I will see what can be done with inferGenotype

  3. Log in to comment