Source

galaxy-central (ngs) / test-data / meme / meme / meme_input_1.fasta

Full commit
>chr21_19617074_19617124_+
AAAAATTATTACTAGGGAGGGGGCCGGAACCTCGGGACGTGGGTATATAA
>chr21_26934381_26934431_+
GCGCCTGGTCGGTTATGAGTCACAAGTGAGTTATAAAAGGGTCGCACGTT
>chr21_28217753_28217803_-
CAAAGGGGAGGAGTGGGGTGGGGGTGGGGGTTTCACTGGTCCACTATAAA
>chr21_31710037_31710087_-
AACACCCAGGTTTCTGAGTATATAATCGCCGCACCAAAGAATTTAATTTT
>chr21_31744582_31744632_-
CCCAGGTCTAAGAGCATATATAACTTGGAGTCCAGACTATGACATTCAAA
>chr21_31768316_31768366_+
AACGTATATAAATGGTCCTGTCCAGATGTGGCATGCAAACTCAGAATCTT
>chr21_31914206_31914256_-
TGACACCCACTACTTAGAGTATAAAATCATTCTGAGAAGTTAGAGACACC
>chr21_31933633_31933683_-
TCAGAGTATATATAAATGTTCCTGTCCAGTCACAGTCACCAAACTGACCT
>chr21_31962741_31962791_-
ACATATAACTCAGGTTGGATAAAATAATTTGTACAAATCAGGAGAGTCAA
>chr21_31964683_31964733_+
TCTGATTCACTGAGGCATATAAAAGGCCCTCTGCGGAGAAGTGTCCATAC
>chr21_31973364_31973414_+
aaacttaaaactctataaacttaaaactCTAGAATCTGATCCTGCTATAC
>chr21_31992870_31992920_+
CTCATACACTATTGAAGATGTATAAAATTTCATTTGCAGATGGTGACATT
>chr21_32185595_32185645_-
TCACCACCCACCAGAGCTGGGATATATAAAGAAGGTTCTGAGACTAGGAA
>chr21_32202076_32202126_-
TGCCCACCAGCTTGAGGTATAAAAAGCCCTGTACGGGAAGAGACCTTCAT
>chr21_32253899_32253949_-
AGCCCCACCCACCAGCAAGGATATATAAAAGCTCAGGAGTCTGGAGTGAC
>chr21_32410820_32410870_-
TCTACCCCACTAATCACTGAGGATGTATAAAAGTCCCAGGGAAGCTGGTG
>chr21_36411748_36411798_-
ATAGTTCTGTATAGTTTCAGTTGGCATCtaaaaattatataactttattt
>chr21_37838750_37838800_-
gatggttttataaggggcctcaccctcggctcagccctcattcttctcct
>chr21_45705687_45705737_+
CCGGGGCGGAGCGGCCTTTGCTCTTTGCGTGGTCGCGGGGGTATAACAGC
>chr21_45971413_45971463_-
CAGGCCCTGGGCATATAAAAGCCCCAGCAGCCAACAGGctcacacacaca
>chr21_45978668_45978718_-
CAGAGGGGTATAAAGGTTCCGACCACTCAGAGGCCTGGCACGAtcactca
>chr21_45993530_45993580_+
CCAAGGAGGAGTATAAAAGCCCCACAAACCCGAGCACCTCACTCACTCGC
>chr21_46020421_46020471_+
GAGACATATAAAAGCCAACATCCCTGAGCACCTAACACACGGactcactc
>chr21_46031920_46031970_+
GGAAAATACCCAGGGAGGGTATAAAACCTCAGCAGCCAGGGCACACAAAC
>chr21_46046964_46047014_+
ACAAGGCCAGGAGGGGTATAAAAGCCTGAGAGCCCCAAGAACctcacaca
>chr21_46057197_46057247_+
ATTGCTGAGTCTCCTGCTGGGAAAACACAGGCCCTGGGCATATAAAAGCC
>chr21_46086869_46086919_-
GACAGGTGTGCTTCTGTGCTGTGGGGATGCCTGGGCCCAGGTATAAAGGC
>chr21_46102103_46102153_-
AGGTGTGTGCTTCTGTGCTGTGGGGATGCCTGGGTCCAGGTATAAAGGCT
>chr21_47517957_47518007_+
CCTGGCGGCGGGGCGGGTCAGGCCGGCGGGGCGGGGTATAAAGGGGGCGG
>chr21_47517957_47518007_+
CCTGGCGGCGGGGCGGGTCAGGCCGGCGGGGCGGGGTATAAAGGGGGCGG
>chr21_47517957_47518007_+
CCTGGCGGCGGGGCGGGTCAGGCCGGCGGGGCGGGGTATAAAGGGGGCGG
>chr21_47575506_47575556_-
TGAGAAGCCGGTGGGGAGGTGCTGCCGGTGAGCGTATAAAGGCCCTGGCG
>chr21_47575506_47575556_-
TGAGAAGCCGGTGGGGAGGTGCTGCCGGTGAGCGTATAAAGGCCCTGGCG