Source

galaxy-central (ngs) / tools / maf / maf_reverse_complement.xml

Full commit
<tool id="MAF_Reverse_Complement_1" name="Reverse Complement" version="1.0.1">
  <description>a MAF file</description>
  <command interpreter="python">maf_reverse_complement.py $input1 $out_file1 $species</command>
  <inputs>
    <page>
        <param format="maf" name="input1" label="Alignment File" type="data"/>
        <param name="species" type="select" display="checkboxes" multiple="true" label="Choose species" help="Select species to be included in the final alignment">
          <options>
            <filter type="data_meta" ref="input1" key="species" />
          </options>
        </param>
    </page>
   </inputs>
  <outputs>
    <data format="maf" name="out_file1" metadata_source="input1"/>
  </outputs>
  <tests>
    <test>
      <param name="input1" value="3.maf" dbkey="hg17" format="maf"/>
      <param name="species" value="hg17,panTro1,mm5,rn3,canFam1"/>
      <output name="out_file1" file="maf_reverse_complement_out.dat"/>
    </test>
  </tests>
  <help>
**What it does**

This tool takes a MAF file and creates a new MAF file, where each block has been reversed complemented.

**Example**
  
This MAF Block::

  a score=8157.000000
  s hg17.chr7    127471526 58 + 158628139 AATTTGTGGTTTATTCATTTTTCATTATTTTGTTTAAGGAGGTCTATAGTGGAAGAGG
  s panTro1.chr6 129885407 58 + 161576975 AATTTGTGGTTTATTCGTTTTTCATTATTTTGTTTAAGGAGGTCTATAGTGGAAGAGG
  s mm5.chr6      28904928 54 + 149721531 AA----CGTTTCATTGATTGCTCATCATTTAAAAAAAGAAATTCCTCAGTGGAAGAGG

becomes::

  a score=8157.000000
  s hg17.chr7     31156555 58 - 158628139 CCTCTTCCACTATAGACCTCCTTAAACAAAATAATGAAAAATGAATAAACCACAAATT
  s panTro1.chr6  31691510 58 - 161576975 CCTCTTCCACTATAGACCTCCTTAAACAAAATAATGAAAAACGAATAAACCACAAATT
  s mm5.chr6     120816549 54 - 149721531 CCTCTTCCACTGAGGAATTTCTTTTTTTAAATGATGAGCAATCAATGAAACG----TT

------

**Citation**

If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. &lt;http://www.ncbi.nlm.nih.gov/pubmed/21775304&gt;`_


  </help>
</tool>