Source

galaxy-central (ngs) / tools / maf / maf_thread_for_species.xml

<tool id="MAF_Thread_For_Species1" name="Join MAF blocks">
  <description>by Species</description>
  <command interpreter="python">maf_thread_for_species.py $input1 $out_file1 $species</command>
  <inputs>
    <param format="maf" name="input1" type="data" label="MAF file"/>
    <param name="species" type="select" label="Species to keep" display="checkboxes" multiple="true">
      <options>
        <filter type="data_meta" ref="input1" key="species" />
      </options>
    </param>
  </inputs>
  <outputs>
    <data format="maf" name="out_file1"  metadata_source="input1"/>
  </outputs>
  <tests>
    <test>
      <param name="input1" value="3.maf" format="maf"/>
      <param name="species" value="hg17,panTro1"/>
      <output name="out_file1" file="maf_thread_for_species.dat"/>
    </test>
  </tests>
  <help>

**What it does**

This tool allows the user to merge MAF blocks which are adjoining in each specified species from a MAF file. Columns which contain only gaps are removed. Species which are not desired are removed from the output.

**Example**

Specifying the desired species as hg17 and panTro1 with this MAF file::

  ##maf version=1
  a score=60426.000000
  s hg17.chr7    127471195 331 + 158628139 gtttgccatcttttgctgctctagggaatccagcagctgtcaccatgtaaacaagcccaggctagaccaGTTACCCTCATCATCTTAGCTGATAGCCAGCCAGCCACCACAGGCAtgagtcaggccatattgctggacccacagaattatgagctaaataaatagtcttgggttaagccactaagttttaggcatagtgtgttatgtaTCTCACAAACATATAAGACTGTGTGTTTGTTGACTGGAGGAAGAGATGCTATAAAGACCACCTTTTAAAACTTCCC-------------------------------AAATACT-GCCACTGATGTCCTG-----ATGGAGGTA-------TGAA-------------------AACATCCACTAA
  s panTro1.chr6 129885076 331 + 161576975 gtttgccatcttttgctgctcttgggaatccagcagctgtcaccatgtaaacaagcccaggctagaccaGTTACCCTCATCATCTTAGCTGATAGCCAGCCAGCCACCACAGGCAtgagtcaggccatattgctggacccacagaattatgagctaaataaatagtcttgggttaagccactaagttttaggcatagtgtgttatgtaTCTCACAAACATATAAGACTGTGTGTTTGTTGACTGGAGGAAGAGATGCTATAAAGACCACCTTTTGAAACTTCCC-------------------------------AAATACT-GCCACTGATGTCCTG-----ATGGAGGTA-------TGAA-------------------AACATCCACTAA
  s mm5.chr6      28904571 357 + 149721531 CTCCACTCTCGTTTGCTGTT----------------CTGTCACCATGGAAACAAA-CGAGGGTGGTCCAGTTACTATCTTGACTGCAGCTGGCAGTCAGTT-GCCACT-----CAGGAATAAGGCTATGCCATT-GATCCACTGAACCGTGATCTGGAAACCTGGCTGTTGTTT-------CAAGCCTTGGGGCCAGTTTGCGGTGTTACTCATGA--CTCTAAGATCGTGTGCTTG----CTGCAGGAAGAGACAGCAAGGGGGTTACATTTAAAAAGCCCCCAGTTTAGCTATAGGCAGGCCAACAGGTGTAAAAATACTCACTAGTAATGGGCTGAACTCATGGAGGTAGCATTAGTGAGACACTGTAACTGTTTTTTTAAAAATCACTAA
  s rn3.chr4      56178191 282 + 187371129 CTTCACTCTCATTTGCTGTT----------------CTGTCACTATGGAGACAAACACAGGCTAGCCCAGTTACTATCTTGATCACAGCAGCT-GTCAGCTAGCTGCCACTCACAGGAATAAGGCCATACCATT-GATCCACTGAACCTTGATCTAGGAATTTGGC----------------------TGGGGCCAGTTTGCGGTGTCACTCATGA--CTCTAAGATTGTGTGTTTG----CTCCAGGAAGAGACGGCAAGAGGATTACCTTTAAAAGGTTC---------------------------------GGAGTCTAGCTGTAGACAGCCCA-----ATG--GGTA-------TAAC-------------------AATACTCACTAA

  a score=8157.000000
  s hg17.chr7    127471526 58 + 158628139 AATTTGTGGTTTATTCATTTTTCATTATTTTGTTTAAGGAGGTCTATAGTGGAAGAGG
  s panTro1.chr6 129885407 58 + 161576975 AATTTGTGGTTTATTCGTTTTTCATTATTTTGTTTAAGGAGGTCTATAGTGGAAGAGG
  s mm5.chr6      28904928 54 + 149721531 AA----CGTTTCATTGATTGCTCATCATTTAAAAAAAGAAATTCCTCAGTGGAAGAGG

results in::

  ##maf version=1
  a score=0.0
  s hg17.chr7    127471195 389 + 158628139 gtttgccatcttttgctgctctagggaatccagcagctgtcaccatgtaaacaagcccaggctagaccaGTTACCCTCATCATCTTAGCTGATAGCCAGCCAGCCACCACAGGCAtgagtcaggccatattgctggacccacagaattatgagctaaataaatagtcttgggttaagccactaagttttaggcatagtgtgttatgtaTCTCACAAACATATAAGACTGTGTGTTTGTTGACTGGAGGAAGAGATGCTATAAAGACCACCTTTTAAAACTTCCCAAATACTGCCACTGATGTCCTGATGGAGGTATGAAAACATCCACTAAAATTTGTGGTTTATTCATTTTTCATTATTTTGTTTAAGGAGGTCTATAGTGGAAGAGG 
  s panTro1.chr6 129885076 389 + 161576975 gtttgccatcttttgctgctcttgggaatccagcagctgtcaccatgtaaacaagcccaggctagaccaGTTACCCTCATCATCTTAGCTGATAGCCAGCCAGCCACCACAGGCAtgagtcaggccatattgctggacccacagaattatgagctaaataaatagtcttgggttaagccactaagttttaggcatagtgtgttatgtaTCTCACAAACATATAAGACTGTGTGTTTGTTGACTGGAGGAAGAGATGCTATAAAGACCACCTTTTGAAACTTCCCAAATACTGCCACTGATGTCCTGATGGAGGTATGAAAACATCCACTAAAATTTGTGGTTTATTCGTTTTTCATTATTTTGTTTAAGGAGGTCTATAGTGGAAGAGG 

------

**Citation**

If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. &lt;http://www.ncbi.nlm.nih.gov/pubmed/21775304&gt;`_


  </help>
</tool>
Tip: Filter by directory path e.g. /media app.js to search for public/media/app.js.
Tip: Use camelCasing e.g. ProjME to search for ProjectModifiedEvent.java.
Tip: Filter by extension type e.g. /repo .js to search for all .js files in the /repo directory.
Tip: Separate your search with spaces e.g. /ssh pom.xml to search for src/ssh/pom.xml.
Tip: Use ↑ and ↓ arrow keys to navigate and return to view the file.
Tip: You can also navigate files with Ctrl+j (next) and Ctrl+k (previous) and view the file with Ctrl+o.
Tip: You can also navigate files with Alt+j (next) and Alt+k (previous) and view the file with Alt+o.