galaxy-central (ngs) / tools / maf / maf_to_interval.xml

<tool id="MAF_To_Interval1" name="MAF to Interval" force_history_refresh="True">
  <description>Converts a MAF formatted file to the Interval format</description>
  <command interpreter="python">maf_to_interval.py $input1 $out_file1 $out_file1.id $__new_file_path__ $input1.dbkey $species $input1.metadata.species $complete_blocks $remove_gaps</command>
  <inputs>
    <param format="maf" name="input1" type="data" label="MAF file to convert"/>
    <param name="species" type="select" label="Select additional species" display="checkboxes" multiple="true" help="The species matching the dbkey of the alignment is always included. A separate history item will be created for each species.">
      <options>
        <filter type="data_meta" ref="input1" key="species" />
        <filter type="remove_value" meta_ref="input1" key="dbkey" />
      </options>
    </param>
    <param name="complete_blocks" type="select" label="Exclude blocks which have a species missing">
      <option value="partial_allowed">include blocks with missing species</option>
      <option value="partial_disallowed">exclude blocks with missing species</option>
    </param>
    <param name="remove_gaps" type="select" label="Remove Gap characters from sequences">
      <option value="keep_gaps">keep gaps</option>
      <option value="remove_gaps">remove gaps</option>
    </param>
  </inputs>
  <outputs>
    <data format="interval" name="out_file1" />
  </outputs>
  <tests>
    <test>
      <param name="input1" value="4.maf" dbkey="hg17"/>
      <param name="complete_blocks" value="partial_disallowed"/>
      <param name="remove_gaps" value="keep_gaps"/>
      <param name="species" value="panTro1" />
      <output name="out_file1" file="maf_to_interval_out_hg17.interval"/>
      <output name="out_file1" file="maf_to_interval_out_panTro1.interval"/>
    </test>
  </tests>
  <help>

**What it does**

This tool converts every MAF block to a set of genomic intervals describing the position of that alignment block within a corresponding genome. Sequences from aligning species are also included in the output.

The interface for this tool contains several options: 

 * **MAF file to convert**. Choose multiple alignments from history to be converted to BED format.
 * **Choose species**. Choose additional species from the alignment to be included in the output 
 * **Exclude blocks which have a species missing**. if an alignment block does not contain any one of the species found in the alignment set and this option is set to **exclude blocks with missing species**, then coordinates of such a block **will not** be included in the output (see **Example 2** below).
 * **Remove Gap characters from sequences**. Gaps can be removed from sequences before they are output.


-----

**Example 1**: **Include only reference genome** (hg18 in this case) and **include blocks with missing species**:

For the following alignment::

  ##maf version=1
  a score=68686.000000
  s hg18.chr20     56827368 75 +  62435964 GACAGGGTGCATCTGGGAGGG---CCTGCCGGGCCTTTA-TTCAACACTAGATACGCCCCATCTCCAATTCTAATGGAC- 
  s panTro2.chr20  56528685 75 +  62293572 GACAGGGTGCATCTGAGAGGG---CCTGCCAGGCCTTTA-TTCAACACTAGATACGCCCCATCTCCAATTCTAATGGAC- 
  s rheMac2.chr10  89144112 69 -  94855758 GACAGGGTGCATCTGAGAGGG---CCTGCTGGGCCTTTG-TTCAAAACTAGATATGCCCCAACTCCAATTCTA------- 
  s mm8.chr2      173910832 61 + 181976762 AGAAGGATCCACCT------------TGCTGGGCCTCTGCTCCAGCAAGACCCACCTCCCAACTCAAATGCCC------- 
  s canFam2.chr24  46551822 67 +  50763139 CG------GCGTCTGTAAGGGGCCACCGCCCGGCCTGTG-CTCAAAGCTACAAATGACTCAACTCCCAACCGA------C 

  a score=10289.000000
  s hg18.chr20    56827443 37 + 62435964 ATGTGCAGAAAATGTGATACAGAAACCTGCAGAGCAG 
  s panTro2.chr20 56528760 37 + 62293572 ATGTGCAGAAAATGTGATACAGAAACCTGCAGAGCAG 
  s rheMac2.chr10 89144181 37 - 94855758 ATGTGCGGAAAATGTGATACAGAAACCTGCAGAGCAG 

the tool will create **a single** history item containing the following (**note** the name field is numbered iteratively: hg18_0_0, hg18_1_0 etc. where the first number is the block number and the second number is the iteration through the block (if a species appears twice in a block, that interval will be repeated) and sequences for each species are included in the order specified in the header: the field is left empty when no sequence is available for that species)::

  #chrom	start	end	strand	score	name	canFam2	hg18	mm8	panTro2	rheMac2
  chr20	56827368	56827443	+	68686.0	hg18_0_0	CG------GCGTCTGTAAGGGGCCACCGCCCGGCCTGTG-CTCAAAGCTACAAATGACTCAACTCCCAACCGA------C	GACAGGGTGCATCTGGGAGGG---CCTGCCGGGCCTTTA-TTCAACACTAGATACGCCCCATCTCCAATTCTAATGGAC-	AGAAGGATCCACCT------------TGCTGGGCCTCTGCTCCAGCAAGACCCACCTCCCAACTCAAATGCCC-------	GACAGGGTGCATCTGAGAGGG---CCTGCCAGGCCTTTA-TTCAACACTAGATACGCCCCATCTCCAATTCTAATGGAC-	GACAGGGTGCATCTGAGAGGG---CCTGCTGGGCCTTTG-TTCAAAACTAGATATGCCCCAACTCCAATTCTA-------
  chr20	56827443	56827480	+	10289.0	hg18_1_0		ATGTGCAGAAAATGTGATACAGAAACCTGCAGAGCAG		ATGTGCAGAAAATGTGATACAGAAACCTGCAGAGCAG	ATGTGCGGAAAATGTGATACAGAAACCTGCAGAGCAG


-----

**Example 2**: **Include hg18 and mm8** and **exclude blocks with missing species**:

For the following alignment::

  ##maf version=1
  a score=68686.000000
  s hg18.chr20     56827368 75 +  62435964 GACAGGGTGCATCTGGGAGGG---CCTGCCGGGCCTTTA-TTCAACACTAGATACGCCCCATCTCCAATTCTAATGGAC- 
  s panTro2.chr20  56528685 75 +  62293572 GACAGGGTGCATCTGAGAGGG---CCTGCCAGGCCTTTA-TTCAACACTAGATACGCCCCATCTCCAATTCTAATGGAC- 
  s rheMac2.chr10  89144112 69 -  94855758 GACAGGGTGCATCTGAGAGGG---CCTGCTGGGCCTTTG-TTCAAAACTAGATATGCCCCAACTCCAATTCTA------- 
  s mm8.chr2      173910832 61 + 181976762 AGAAGGATCCACCT------------TGCTGGGCCTCTGCTCCAGCAAGACCCACCTCCCAACTCAAATGCCC------- 
  s canFam2.chr24  46551822 67 +  50763139 CG------GCGTCTGTAAGGGGCCACCGCCCGGCCTGTG-CTCAAAGCTACAAATGACTCAACTCCCAACCGA------C 

  a score=10289.000000
  s hg18.chr20    56827443 37 + 62435964 ATGTGCAGAAAATGTGATACAGAAACCTGCAGAGCAG 
  s panTro2.chr20 56528760 37 + 62293572 ATGTGCAGAAAATGTGATACAGAAACCTGCAGAGCAG 
  s rheMac2.chr10 89144181 37 - 94855758 ATGTGCGGAAAATGTGATACAGAAACCTGCAGAGCAG 

the tool will create **two** history items (one for hg18 and one for mm8) containing the following (**note** that both history items contain only one line describing the first alignment block. The second MAF block is not included in the output because it does not contain mm8):

History item **1** (for hg18)::

   #chrom	start	end	strand	score	name	canFam2	hg18	mm8	panTro2	rheMac2
   chr20	56827368	56827443	+	68686.0	hg18_0_0	CG------GCGTCTGTAAGGGGCCACCGCCCGGCCTGTG-CTCAAAGCTACAAATGACTCAACTCCCAACCGA------C	GACAGGGTGCATCTGGGAGGG---CCTGCCGGGCCTTTA-TTCAACACTAGATACGCCCCATCTCCAATTCTAATGGAC-	AGAAGGATCCACCT------------TGCTGGGCCTCTGCTCCAGCAAGACCCACCTCCCAACTCAAATGCCC-------	GACAGGGTGCATCTGAGAGGG---CCTGCCAGGCCTTTA-TTCAACACTAGATACGCCCCATCTCCAATTCTAATGGAC-	GACAGGGTGCATCTGAGAGGG---CCTGCTGGGCCTTTG-TTCAAAACTAGATATGCCCCAACTCCAATTCTA-------


History item **2** (for mm8)::

   #chrom	start	end	strand	score	name	canFam2	hg18	mm8	panTro2	rheMac2
   chr2	173910832	173910893	+	68686.0	mm8_0_0	CG------GCGTCTGTAAGGGGCCACCGCCCGGCCTGTG-CTCAAAGCTACAAATGACTCAACTCCCAACCGA------C	GACAGGGTGCATCTGGGAGGG---CCTGCCGGGCCTTTA-TTCAACACTAGATACGCCCCATCTCCAATTCTAATGGAC-	AGAAGGATCCACCT------------TGCTGGGCCTCTGCTCCAGCAAGACCCACCTCCCAACTCAAATGCCC-------	GACAGGGTGCATCTGAGAGGG---CCTGCCAGGCCTTTA-TTCAACACTAGATACGCCCCATCTCCAATTCTAATGGAC-	GACAGGGTGCATCTGAGAGGG---CCTGCTGGGCCTTTG-TTCAAAACTAGATATGCCCCAACTCCAATTCTA-------


-------

.. class:: infomark

**About formats**

**MAF format** multiple alignment format file. This format stores multiple alignments at the DNA level between entire genomes. 

 - The .maf format is line-oriented. Each multiple alignment ends with a blank line.
 - Each sequence in an alignment is on a single line.
 - Lines starting with # are considered to be comments.
 - Each multiple alignment is in a separate paragraph that begins with an "a" line and contains an "s" line for each sequence in the multiple alignment.
 - Some MAF files may contain two optional line types: 

   - An "i" line containing information about what is in the aligned species DNA before and after the immediately preceding "s" line; 
   - An "e" line containing information about the size of the gap between the alignments that span the current block.

------

**Citation**

If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. &lt;http://www.ncbi.nlm.nih.gov/pubmed/21775304&gt;`_


    </help>
</tool>
Tip: Filter by directory path e.g. /media app.js to search for public/media/app.js.
Tip: Use camelCasing e.g. ProjME to search for ProjectModifiedEvent.java.
Tip: Filter by extension type e.g. /repo .js to search for all .js files in the /repo directory.
Tip: Separate your search with spaces e.g. /ssh pom.xml to search for src/ssh/pom.xml.
Tip: Use ↑ and ↓ arrow keys to navigate and return to view the file.
Tip: You can also navigate files with Ctrl+j (next) and Ctrl+k (previous) and view the file with Ctrl+o.
Tip: You can also navigate files with Alt+j (next) and Alt+k (previous) and view the file with Alt+o.