Commits

Daniel Blankenberg committed 314d41d

Minor tool help updates.

  • Participants
  • Parent commits 435e3f6

Comments (0)

Files changed (8)

tools/fastx_toolkit/fasta_clipping_histogram.xml

 
 Use the **FASTA Collapser** tool to create FASTA files with multiplicity counts.
 
+------
+
+This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
+
+ .. __: http://hannonlab.cshl.edu/fastx_toolkit/
+ 
 </help>
 </tool>
 <!-- FASTA-Clipping-Histogram is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->

tools/fastx_toolkit/fasta_formatter.xml

     AGGAATGATGACTACAATGATCAACTTAACCTATCTATTTAATTTAGTTCCCTAATGTCAGGGACCTACCTGTTTTTGTTATGTTTGGGTTTTGTTGTTGTTGTTTTTTTAATCTGAAGGTATTGTGCATTATATGACCTGTAATACACAATTAAAGTCAATTTTAATGAACATGTAGTAAAAACT
     >Scaffold9299
     CAGCATCTACATAATATGATCGCTATTAAACTTAAATCTCCTTGACGGAGTCTTCGGTCATAACACAAACCCAGACCTACGTATATGACAAAGCTAATAGaactggtctttacctTTAAGTTG
+
+------
+
+This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
+
+ .. __: http://hannonlab.cshl.edu/fastx_toolkit/
+ 
 </help>
 </tool>

tools/fastx_toolkit/fasta_nucleotide_changer.xml

     >cel-miR-1 MIMAT0000003 Caenorhabditis elegans miR-1
     TGGAATGTAAAGAAGTATGTA
 
+
+------
+
+This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
+
+ .. __: http://hannonlab.cshl.edu/fastx_toolkit/
+ 
 </help>
 </tool>

tools/fastx_toolkit/fastx_barcode_splitter.xml

 
 .. image:: ./static/fastx_icons/barcode_splitter_output_example.png
 
+
+------
+
+This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
+
+ .. __: http://hannonlab.cshl.edu/fastx_toolkit/
+ 
 </help>
 </tool>
 <!-- FASTX-barcode-splitter is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->

tools/fastx_toolkit/fastx_clipper.xml

 
 
 
-    
+
+------
+
+This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
+
+ .. __: http://hannonlab.cshl.edu/fastx_toolkit/
+ 
 </help>
 </tool>

tools/fastx_toolkit/fastx_collapser.xml

 
 means that the sequence "ATAT" is the second sequence in the file, and it appeared 4 times in the input FASTA file.
 
+
+------
+
+This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
+
+ .. __: http://hannonlab.cshl.edu/fastx_toolkit/
+ 
 </help>
 </tool>

tools/plotting/boxplot.xml

 
 .. image:: ./static/images/solid_qual.png
 
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. &lt;http://www.ncbi.nlm.nih.gov/pubmed/20562416&gt;`_
+
 
   </help>
 </tool>

tools/visualization/GMAJ.xml

 
 For detailed information on GMAJ, click here_.
 
+
+------
+
+**Citation**
+
+If you use GMAJ, please cite `Blanchette M, Kent WJ, Riemer C, Elnitski L, Smit AF, Roskin KM, Baertsch R, Rosenbloom K, Clawson H, Green ED, Haussler D, Miller W. Aligning multiple genomic sequences with the threaded blockset aligner. Genome Res. 2004 Apr;14(4):708-15. &lt;http://www.ncbi.nlm.nih.gov/pubmed/15060014&gt;`_ and http://globin.cse.psu.edu/dist/gmaj/. 
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. &lt;http://www.ncbi.nlm.nih.gov/pubmed/21775304&gt;`_
+
+
 .. _here: /static/gmaj/docs/gmaj_readme.html
 .. _TBA: http://www.bx.psu.edu/miller_lab/
   </help>