1. Sarah Richardson
  2. GeneDesign-dev


Sarah Richardson  committed 0c48d12

Version 5.5: No segmentation

  • Participants
  • Parent commits ac80abc
  • Branches master

Comments (0)

Files changed (48)

File BioGrepPatch/BackendI.patch

-< use UNIVERSAL qw(isa);
-> #use UNIVERSAL qw(isa);

File BioGrepPatch/Vmatch.patch

-<     if ( !$args->{alignment}->no_sequences ) {
->     if ( !$args->{alignment}->num_sequences ) {

File Build.PL

View file
 my $llt = 0;
 my ($cpath,  $spath,  $tpath) =  (       q{},                 q{},        q{});
 my ($dcpath, $dspath, $dtpath) = ('/etc/GeneDesign/', '/usr/local/bin', '/tmp');
-my ($g,  $e,  $bl,  $v) =  ( 0,   0,   0,   0);
-my ($dg, $de, $dbl, $dv) = ("Y", "Y", "Y", "Y");
+my ($g, $dg) =  ( 0,   q{Y});
 my $check = eval
   $dtpath = Bio::GeneDesign::ConfigData->config('tmp_path')         || $dtpath;
   $dspath = Bio::GeneDesign::ConfigData->config('script_path')      || $dspath;
   $dg =     Bio::GeneDesign::ConfigData->config('graphing_support') || $dg;
-  $dbl =    Bio::GeneDesign::ConfigData->config('BLAST_support')    || $dbl;
-  $de =     Bio::GeneDesign::ConfigData->config('EMBOSS_support')   || $de;
-  $dv =     Bio::GeneDesign::ConfigData->config('vmatch_support')   || $dv;
 my $GDB = Module::Build->new
     module_name         => 'Bio::GeneDesign',
     license             => 'bsd',
     dist_author         => q{Sarah Richardson <SMRichardson@lbl.gov>},
-    dist_version        => '5.00',
+    dist_version        => '5.50',
     dist_abstract       => 'Functions for the design of synthetic genes',
     add_to_cleanup      => [ 'Bio::GeneDesign-*' ],
     create_makefile_pl  => 'traditional',
           'GD::Image'         => 0
-      palindrome =>
-      {
-        description => 'Enable EMBOSS palindrome for hairpin detection',
-        requires    =>
-        {
-          'Bio::Factory::EMBOSS' => 0,
-          'Bio::Tools::EMBOSS::Palindrome' => 0
-        }
-      },
-      blast =>
-      {
-        description => 'Enable BLAST+ for similarity detection',
-        requires    =>
-        {
-          'Bio::Tools::Run::StandAloneBlastPlus' => 0
-        }
-      },
-      vmatch =>
-      {
-        description => 'Enable vmatch for similarity detection',
-        requires    =>
-        {
-          'Bio::Grep::Backend::Vmatch' => '0.10.6'
-        }
-      }
     script_files =>
-      'bin/GD_Design_Building_Blocks.pl',
-      'bin/GD_Design_Oligos.pl',
         store => \$g,
         type => '=s',
-      EMBOSS_support =>
-      {
-        store => \$e,
-        type => '=s',
-      },
-      BLAST_support =>
-      {
-        store => \$bl,
-        type => '=s',
-      },
-      vmatch_support =>
-      {
-        store => \$v,
-        type => '=s',
-      },
     $tpath = prompt('Where should GeneDesign write tmp files?', $dtpath);
   if (! $g && $GDB->feature('graphing'))
     $g = y_n('Enable GD::Graphics support?', $dg);
-  if (! $e && $GDB->feature('palindrome'))
-  {
-    $e = y_n('Enable EMBOSS palindrome for hairpin detection?', $de);
-  }
-  if (! $bl && $GDB->feature('blast'))
-  {
-    $bl = y_n('Enable BLAST+ for similarity detection?', $dbl);
-  }
-  if (! $v && $GDB->feature('vmatch'))
-  {
-    $v = y_n('Enable vmatch for similarity detection?', $dv);
-  }
   $tpath = $tpath || $dtpath;
   $spath = $spath || $dspath;
   $g = $g || $dg;
-  $e = $e || $de;
-  $bl = $bl || $dbl;
-  $v = $v || $dv;
 $GDB->config_data(conf_path => $cpath);
 $GDB->config_data(tmp_path => $tpath);
 $GDB->config_data(script_path => $spath);
 $GDB->config_data(graphing_support => $g) if ($GDB->feature('graphing'));
-$GDB->config_data(EMBOSS_support => $e)   if ($GDB->feature('palindrome'));
-$GDB->config_data(BLAST_support => $bl)   if ($GDB->feature('blast'));
-$GDB->config_data(vmatch_support => $v)   if ($GDB->feature('vmatch'));
 #Prepare configuration directory
 my $tcp = $GDB->config_data('conf_path');
-  'vectors/pENTR_SD_SmaI.genbank',
-  'vectors/pEC-K18mob2.genbank',
-  'vectors/pET29b-plus_SMR.genbank',
-  'vectors/pET45b-SmaI.genbank',
-  'vectors/peU_HSBC_NcoI_RAH_GD.genbank',
-  'vectors/pFIL-B-2_ScaI.genbank',
-  'vectors/pK18mobsacB.genbank',
-  'vectors/pMCC.genbank',
-  'vectors/pNJ020_GD.genbank',
-  'vectors/pNJ022_GD.genbank'
 process_conf_files($GDB, $confs);
 print 'Temporary files will be written to ', $GDB->config_data('tmp_path'), "\n";
-if ($GDB->config_data('BLAST_support'))
-  my $blq = `which blastn`;
-  croak ('Either BLAST+ is not installed or it is not on my PATH') unless ($blq);
-  my ($y, $blpath) = fileparse($blq);
-  $GDB->config_data('blast_path' => $blpath);
-  print "Will use BLAST+ executables found in $blpath\n";
-if ($GDB->config_data('vmatch_support'))
-  my $vl = `which vmatch`;
-  croak ('Either vmatch is not installed or it is not on my PATH') unless ($vl);
-  my ($y, $vlpath) = fileparse($vl);
-  print "Will use vmatch executables found in $vlpath\n";
 print "\n";

File Changes

View file
 Revision history for Bio::GeneDesign
+5.50 13.10.21
+	Took out all segmentation (building block and oligo design) and removed to
+	a separate package.
 5.00  12.05.12
   Added an OO interface for GeneDesign
   updated every library, they are no longer called directly


View file
 MANIFEST			This list of files


View file
-Copyright (c) 2012, GeneDesign developers
+Copyright (c) 2013, GeneDesign developers
 All rights reserved.
 Redistribution and use in source and binary forms, with or without modification,

File bin/GD_Filter_Enzymes.pl

View file
 use strict;
 use warnings;
-my $VERSION = '5.00';
+my $VERSION = '5.50';
 my $GDV = "GD_Filter_Enzymes$VERSION";
 local $| = 1;
 =head1 VERSION
-  Version 5.00
+  Version 5.50

File bin/GD_Generate_RSCU_Table.pl

View file
 use strict;
 use warnings;
-my $VERSION = '5.00';
+my $VERSION = '5.50';
 my $GDV = "GD_Generate_RSCU_Table_$VERSION";
 my $GDS = ".rscu";
 =head1 VERSION
-  Version 5.00
+  Version 5.50
-Copyright (c) 2012, GeneDesign developers
+Copyright (c) 2013, GeneDesign developers
 All rights reserved.
 Redistribution and use in source and binary forms, with or without modification,

File bin/GD_Graph_Dotplot.pl

View file
 use strict;
 use warnings;
-my $VERSION = '5.00';
+my $VERSION = '5.50';
 my $GDV = "GD_Graph_Dotplot_$VERSION";
 local $| = 1;
 =head1 VERSION
-  Version 5.00
+  Version 5.50

File bin/GD_Graph_RSCU_Values.pl

View file
 use strict;
 use warnings;
-my $VERSION = '5.00';
+my $VERSION = '5.50';
 my $GDV = "GD_Graph_RSCU_Values_$VERSION";
 my $GDS = "_GRV";
 =head1 VERSION
-  Version 5.00
+  Version 5.50
-Copyright (c) 2012, GeneDesign developers
+Copyright (c) 2013, GeneDesign developers
 All rights reserved.
 Redistribution and use in source and binary forms, with or without modification,

File bin/GD_Juggle_Codons.pl

View file
 use strict;
 use warnings;
-my $VERSION = '5.00';
+my $VERSION = '5.50';
 my $GDV = "GD_Juggle_Codons_$VERSION";
 my $GDS = "_CJ";
 =head1 VERSION
-  Version 5.00
+  Version 5.50
-Copyright (c) 2012, GeneDesign developers
+Copyright (c) 2013, GeneDesign developers
 All rights reserved.
 Redistribution and use in source and binary forms, with or without modification,

File bin/GD_Reverse_Translate.pl

View file
 use strict;
 use warnings;
-my $VERSION = '5.00';
+my $VERSION = '5.50';
 my $GDV = "GD_Reverse_Translate_$VERSION";
 my $GDS = "_RT";
 =head1 VERSION
-  Version 5.00
+  Version 5.50
-Copyright (c) 2012, GeneDesign developers
+Copyright (c) 2013, GeneDesign developers
 All rights reserved.
 Redistribution and use in source and binary forms, with or without modification,

File bin/GD_Sequence_Subtraction.pl

View file
 use strict;
 use warnings;
-my $VERSION = '5.00';
+my $VERSION = '5.50';
 my $GDV = "GD_Sequence_Subtraction_$VERSION";
 my $GDS = "_SS";
 =head1 VERSION
-  Version 5.00
+  Version 5.50
-Copyright (c) 2012, GeneDesign developers
+Copyright (c) 2013, GeneDesign developers
 All rights reserved.
 Redistribution and use in source and binary forms, with or without modification,

File lib/Bio/GeneDesign.pm

View file
 =head1 VERSION
-Version 5.00
+Version 5.50
 use Bio::GeneDesign::RestrictionEnzymes qw(:GD);
 use Bio::GeneDesign::ReverseTranslate qw(:GD);
 use Bio::GeneDesign::PrefixTree;
-use Bio::GeneDesign::Vector;
 use File::Basename;
 use Bio::SeqIO;
 use Carp;
 use strict;
 use warnings;
-my $VERSION = 5.00;
+my $VERSION = 5.50;
   return $graph;
-=head2 load_vector
-sub load_vector
-  my ($self, @args) = @_;
-  my ($vname, $vpath)
-    = $self->_rearrange([qw(name path)], @args);
-  $vname = $vname || "custom_vector";
-  if ($vname && ! $vpath)
-  {
-    $vpath = $self->{conf} . "vectors/" . $vname . ".genbank";
-    $self->throw("Can't find $vname in configuration $vpath")
-      unless (-e $vpath);
-  }
-  my $vector = Bio::GeneDesign::Vector->new(-name => $vname, -path => $vpath);
-  return $vector;
 =head2 import_seqs
-Copyright (c) 2012, GeneDesign developers
+Copyright (c) 2013, GeneDesign developers
 All rights reserved.
 Redistribution and use in source and binary forms, with or without modification,

File lib/Bio/GeneDesign/Basic.pm

View file
 =head1 VERSION
-Version 5.00
+Version 5.50
 use strict;
 use warnings;
-our $VERSION = 5.00;
+our $VERSION = 5.50;
 use base qw(Exporter);
 our @EXPORT_OK = qw(
-Copyright (c) 2012, GeneDesign developers
+Copyright (c) 2013, GeneDesign developers
 All rights reserved.
 Redistribution and use in source and binary forms, with or without modification,

File lib/Bio/GeneDesign/Blast.pm

-# GeneDesign using Blast
-=head1 NAME
-=head1 VERSION
-Version 5.00
-Vmatch interface
-=head1 AUTHOR
-Sarah Richardson <SMRichardson@lbl.gov>.
-package Bio::GeneDesign::Blast;
-require Exporter;
-use Bio::Tools::Run::StandAloneBlastPlus;
-use strict;
-use warnings;
-our $VERSION = 5.00;
-use base qw(Exporter);
-our @EXPORT_OK = qw(
-  _filter_blast
-our %EXPORT_TAGS =  (GD => \@EXPORT_OK);
-=head1 Functions
-=head2 _filter_blast()
-sub _filter_blast
-  my ($parent, $seqarrs, $percent, $writedir) = @_;
-  #Make the BLAST factory
-  my $factory = Bio::Tools::Run::StandAloneBlastPlus->new(
-                          -program => 'blastn',
-                          -db_dir  => $writedir,
-                          -db_data => $parent);
-  #BLAST everything in the array
-  my %hits = map {$_->id => 0} @$seqarrs;
-  my %objs = map {$_->id => $_} @$seqarrs;
-  $factory->run(
-     -method => "blastn",
-      -query => $seqarrs,
-      -method_args => [ -word_size => 4,
-                        -perc_identity => $percent,
-                        -gapextend => 2,
-                        -gapopen => 0,
-                        -penalty => -1]);
-  while (my $result = $factory->next_result)
-  {
-    my $name = $result->query_name();
-    my $qlen = length($objs{$name}->seq);
-    while( my $hit = $result->next_hit())
-    {
-      while( my $hsp = $hit->next_hsp())
-      {
-        my $hlen = length($hsp->hit_string);
-        $hits{$name}++ if ($hlen >= 0.7*$qlen && $hsp->evalue < 0.0001);
-      }
-    }
-  }
-  #Clean up and return
-  $factory->cleanup;
-  my @cleans = grep {$hits{$_->id} == 1} @$seqarrs;
-  return \@cleans;
-Copyright (c) 2012, GeneDesign developers
-All rights reserved.
-Redistribution and use in source and binary forms, with or without modification,
-are permitted provided that the following conditions are met:
-* Redistributions of source code must retain the above copyright notice, this
-list of conditions and the following disclaimer.
-* Redistributions in binary form must reproduce the above copyright notice, this
-list of conditions and the following disclaimer in the documentation and/or
-other materials provided with the distribution.
-* The names of Johns Hopkins, the Joint Genome Institute, the Lawrence Berkeley
-National Laboratory, the Department of Energy, and the GeneDesign developers may
-not be used to endorse or promote products derived from this software without
-specific prior written permission.

File lib/Bio/GeneDesign/CodonJuggle.pm

View file
 =head1 VERSION
-Version 5.00
+Version 5.50
 use strict;
 use warnings;
-our $VERSION = 5.00;
+our $VERSION = 5.50;
 use base qw(Exporter);
 our @EXPORT_OK = qw(

File lib/Bio/GeneDesign/Codons.pm

View file
 =head1 VERSION
-Version 5.00
+Version 5.50
 use strict;
 use warnings;
-our $VERSION = 5.00;
+our $VERSION = 5.50;
 use base qw(Exporter);
 our @EXPORT_OK = qw(
-Copyright (c) 2012, GeneDesign developers
+Copyright (c) 2013, GeneDesign developers
 All rights reserved.
 Redistribution and use in source and binary forms, with or without modification,

File lib/Bio/GeneDesign/Exceptions.pm

View file
 =head1 VERSION
-Version 5.00
+Version 5.50

File lib/Bio/GeneDesign/Graph.pm

View file
 =head1 VERSION
-Version 5.00
+Version 5.50
 use strict;
 use warnings;
-our $VERSION = 5.00;
+our $VERSION = 5.50;
 use base qw(Exporter);
 our @EXPORT_OK = qw(
-Copyright (c) 2012, GeneDesign developers
+Copyright (c) 2013, GeneDesign developers
 All rights reserved.
 Redistribution and use in source and binary forms, with or without modification,

File lib/Bio/GeneDesign/Oligo.pm

View file
 =head1 VERSION
-Version 5.00
+Version 5.50
 use strict;
 use warnings;
-our $VERSION = 5.00;
+our $VERSION = 5.50;
 use base qw(Exporter);
 our @EXPORT_OK = qw(
-Copyright (c) 2012, GeneDesign developers
+Copyright (c) 2013, GeneDesign developers
 All rights reserved.
 Redistribution and use in source and binary forms, with or without modification,

File lib/Bio/GeneDesign/Palindrome.pm

-# GeneDesign using EMBOSS palindrome
-=head1 NAME
-=head1 VERSION
-Version 5.00
-EMBOSS Palindrome interface
-=head1 AUTHOR
-Sarah Richardson <SMRichardson@lbl.gov>.
-package Bio::GeneDesign::Palindrome;
-require Exporter;
-use Digest::MD5 qw(md5_hex);
-use Bio::Factory::EMBOSS;
-use Bio::Tools::EMBOSS::Palindrome;
-use strict;
-use warnings;
-our $VERSION = 5.00;
-use base qw(Exporter);
-our @EXPORT_OK = qw(
-  _filter_palindromes
-our %EXPORT_TAGS =  (GD => \@EXPORT_OK);
-=head1 Functions
-=head2 _filter_palindromes()
-sub _filter_palindromes
-  my ($seqarr, $minlen, $maxlen, $gaplimit, $mismatches, $writedir) = @_;
-  #Write out everything in the seqarr to a FASTA file
-  my $rand = md5_hex(md5_hex(time().{}.rand().$$));
-  my $path = $writedir . "$rand.FASTA";
-  open (my $FOUT, '>',  $path) || croak ("can't write tmp pal file: $!");
-  print $FOUT ">" . $_->id . "\n" . $_->seq . "\n" foreach (@$seqarr);
-  close $FOUT;
-  #Run the palindrome program and write out to a .pal file
-  my $factory = Bio::Factory::EMBOSS->new();
-  my $app = $factory->program('palindrome');
-  my $out = $writedir . "$rand.pal";
-  $app->run({
-      -sequence => $path,
-      -minpallen => $minlen,
-      -maxpallen => $maxlen,
-      -gaplimit => $gaplimit,
-      -outfile => $out,
-      -nummismatches => $mismatches});
-  #Parse the .pal file and keep only sequences without secondary structure
-  my $parser = Bio::Tools::EMBOSS::Palindrome->new(-file => $out);
-  my %hpids;
-  while( my $seq = $parser->next_seq )
-  {
-    my @hpins = $seq->get_SeqFeatures;
-    $hpids{$seq->id}++ if (scalar @hpins);
-    #foreach my $feat ( @hpins )
-    #{
-    #print $seq->id;
-    #my ($a, $b, $c, $d) = ($feat->start + $seq->id, $feat->end + $seq->id,
-    #  $feat->hstart + $seq->id, $feat->hend + $seq->id);
-    #print " has a repeat from $a..$b and $c..$d\n\n";
-    #}
-  }
-  #Clean up and return
-  system "rm $out" || croak ("Can't clean up? $!");
-  system "rm $path" || croak ("Can't clean up? $!");
-  my @cleans = grep {! exists $hpids{$_->id}} @$seqarr;
-  return \@cleans;
-Copyright (c) 2012, GeneDesign developers
-All rights reserved.
-Redistribution and use in source and binary forms, with or without modification,
-are permitted provided that the following conditions are met:
-* Redistributions of source code must retain the above copyright notice, this
-list of conditions and the following disclaimer.
-* Redistributions in binary form must reproduce the above copyright notice, this
-list of conditions and the following disclaimer in the documentation and/or
-other materials provided with the distribution.
-* The names of Johns Hopkins, the Joint Genome Institute, the Lawrence Berkeley
-National Laboratory, the Department of Energy, and the GeneDesign developers may
-not be used to endorse or promote products derived from this software without
-specific prior written permission.

File lib/Bio/GeneDesign/PrefixTree.pm

View file
 =head1 VERSION
-Version 5.00
+Version 5.50
 use strict;
 use warnings;
-my $VERSION = 5.00;
+my $VERSION = 5.50;
 =head1 Functions

File lib/Bio/GeneDesign/Random.pm

View file
 =head1 VERSION
-Version 5.00
+Version 5.50
 use strict;
 use warnings;
-our $VERSION = 5.00;
+our $VERSION = 5.50;
 use base qw(Exporter);
 our @EXPORT_OK = qw(
-Copyright (c) 2012, GeneDesign developers
+Copyright (c) 2013, GeneDesign developers
 All rights reserved.
 Redistribution and use in source and binary forms, with or without modification,

File lib/Bio/GeneDesign/RestrictionEnzyme.pm

View file
 =head1 VERSION
-Version 5.00
+Version 5.50
 use base qw(Bio::Root::Root);
-our $VERSION = 5.00;
+our $VERSION = 5.50;
 my $IIPreg  = qr/   ([A-Z]*)   \^ ([A-Z]*)      /x;
 my $IIAreg  = qr/\A \w+ \(([\-]*\d+) \/ ([\-]*\d+)\)\Z  /x;
-Copyright (c) 2012, GeneDesign developers
+Copyright (c) 2013, GeneDesign developers
 All rights reserved.
 Redistribution and use in source and binary forms, with or without modification,

File lib/Bio/GeneDesign/RestrictionEnzymes.pm

View file
 =head1 VERSION
-Version 5.00
+Version 5.50
 use strict;
 use warnings;
-our $VERSION = 5.00;
+our $VERSION = 5.50;
 use base qw(Exporter);
 our @EXPORT_OK = qw(
-Copyright (c) 2012, GeneDesign developers
+Copyright (c) 2013, GeneDesign developers
 All rights reserved.
 Redistribution and use in source and binary forms, with or without modification,

File lib/Bio/GeneDesign/ReverseTranslate.pm

View file
 =head1 VERSION
-Version 5.00
+Version 5.50
 use strict;
 use warnings;
-our $VERSION = 5.00;
+our $VERSION = 5.50;
 use base qw(Exporter);
 our @EXPORT_OK = qw(
-Copyright (c) 2012, GeneDesign developers
+Copyright (c) 2013, GeneDesign developers
 All rights reserved.
 Redistribution and use in source and binary forms, with or without modification,

File lib/Bio/GeneDesign/Vector.pm

-# GeneDesign module for vector objects
-=head1 NAME
-=head1 VERSION
-Version 5.00
-GeneDesign object that represents a vector
-=head1 AUTHOR
-Sarah Richardson <SMRichardson@lbl.gov>
-package Bio::GeneDesign::Vector;
-use Bio::SeqIO;
-use Carp;
-use strict;
-use warnings;
-use base qw(Bio::Root::Root);
-our $VERSION = 5.00;
-=head2 new
-sub new
-  my ($class, @args) = @_;
-  my $self = $class->SUPER::new(@args);
-  my ($name, $path) = $self->_rearrange([qw(NAME PATH)], @args);
-  my $iterator = Bio::SeqIO->new(-file => $path)
-    || $self->throw("Can't parse $path!");
-  my @VECS;
-  while ( my $obj = $iterator->next_seq() )
-  {
-    push @VECS, $obj;
-  }
-  $self->throw("Too many vectors in file at $path") if (scalar(@VECS) > 1);
-  $self->throw("No vectors in file at $path") if (scalar(@VECS) == 0);
-  $self->{name} = $name;
-  $self->{seqobj} = $VECS[0];
-  $self->{seq} = $VECS[0]->seq;
-  $self->{len} = length $self->{seq};
-  my @feats = $self->{seqobj}->get_SeqFeatures;
-  $self->{features} = \@feats;
-  my @es = grep {$_->primary_tag eq "protein_bind"} @feats;
-  my @exes = map {join(q{}, $_->get_tag_values("label"))} @es;
-  my @ps = grep {$_->primary_tag eq "primer_bind"} @feats;
-  my %dsubs = map {join(q{}, $_->get_tag_values("label")) => $_} @ps;
-  if (exists $dsubs{"CLH5"})
-  {
-    $self->{chew5} = uc $dsubs{"CLH5"}->seq->seq;
-    $self->{chew5loc} = $dsubs{"CLH5"}->start;
-  }
-  else
-  {
-    carp ("$name has no CLH5 sequence annotated");
-    $self->{chew5} = q{};
-    $self->{chew5loc} = 0;
-  }
-  if (exists $dsubs{"CLH3"})
-  {
-    $self->{chew3} = uc $dsubs{"CLH3"}->seq->seq;
-    $self->{chew3loc} = $dsubs{"CLH3"}->start;
-  }
-  else
-  {
-    carp ("$name has no CLH3 sequence annotated");
-    $self->{chew3} = q{};
-    $self->{chew3loc} = 0;
-  }
-  $self->{enzyme_list} = \@exes;
-  return $self;
-=head2 clone
-sub clone
-   my ($self) = @_;
-   my $copy;
-   foreach my $key (keys %$self)
-   {
-     if (ref $self->{$key} eq "ARRAY")
-     {
-       $copy->{$key} = [@{$self->{$key}}];
-     }
-     elsif (ref $self->{$key} eq "HASH")
-     {
-       $copy->{$key} = {%{$self->{$key}}};
-     }
-     else
-     {
-      $copy->{$key} = $self->{$key};
-     }
-   }
-   bless $copy, ref $self;
-   return $copy;
-Methods for setting and accessing vector attributes
-=head2 name
-sub name
-  my ($self) = @_;
-  return $self->{'name'};
-=head2 id
-sub id
-  my ($self) = @_;
-  return $self->{'name'};
-=head2 seq
-sub seq
-  my ($self) = @_;
-  return $self->{'seq'};
-=head2 len
-sub len
-  my ($self) = @_;
-  return $self->{'len'};
-=head2 seqobj
-sub seqobj
-  my ($self) = @_;
-  return $self->{'seqobj'};
-=head2 chew5
-sub chew5
-  my ($self) = @_;
-  return $self->{'chew5'};
-=head2 chew5loc
-sub chew5loc
-  my ($self) = @_;
-  return $self->{chew5loc};
-=head2 chew3
-sub chew3
-  my ($self) = @_;
-  return $self->{'chew3'};
-=head2 chew3loc
-sub chew3loc
-  my ($self) = @_;
-  return $self->{chew3loc};
-=head2 enzyme_list
-sub enzyme_list
-  my ($self) = @_;
-  return @{$self->{'enzyme_list'}};
-Copyright (c) 2012, GeneDesign developers
-All rights reserved.
-Redistribution and use in source and binary forms, with or without modification,
-are permitted provided that the following conditions are met:
-* Redistributions of source code must retain the above copyright notice, this
-list of conditions and the following disclaimer.
-* Redistributions in binary form must reproduce the above copyright notice, this
-list of conditions and the following disclaimer in the documentation and/or
-other materials provided with the distribution.
-* The names of Johns Hopkins, the Joint Genome Institute, the Lawrence Berkeley
-National Laboratory, the Department of Energy, and the GeneDesign developers may
-not be used to endorse or promote products derived from this software without
-specific prior written permission.

File lib/Bio/GeneDesign/Vmatch.pm

-# GeneDesign using Vmatch
-=head1 NAME
-=head1 VERSION
-Version 5.00
-Vmatch interface
-=head1 AUTHOR
-Sarah Richardson <SMRichardson@lbl.gov>.
-package Bio::GeneDesign::Vmatch;
-require Exporter;
-use Digest::MD5 qw(md5_hex);
-use Carp;
-use Bio::Grep;
-use strict;
-use warnings;
-our $VERSION = 5.00;
-use base qw(Exporter);
-our @EXPORT_OK = qw(
-  _filter_vmatch
-  _search_vmatch
-our %EXPORT_TAGS =  (GD => \@EXPORT_OK);
-=head1 Functions
-=head2 _filter_vmatch()
-sub _filter_vmatch
-  my ($parent, $seqarrs, $mismatches, $revcom, $writedir) = @_;
-  my $rand = md5_hex(md5_hex(time().{}.rand().$$));
-  my $band = md5_hex(md5_hex(time().{}.rand().$$));
-  #Write the parent to a FASTA file
-  my $dbpath = $writedir . "$rand.FASTA";
-  open (my $POUT, '>', $dbpath) || croak($!);
-  print $POUT ">" . $parent->id . "\n" . $parent->seq . "\n";
-  close $POUT;
-  #Write the queries to a FASTA file
-  my $datapath = $writedir . "$band.FASTA";
-  open (my $DOUT, '>', $datapath) || croak($!);
-  print $DOUT ">" . $_->id . "\n" . $_->seq . "\n" foreach (@$seqarrs);
-  close $DOUT;
-  #Make the vmatch database
-  my $sbe = Bio::Grep->new('Vmatch');
-  $sbe->settings->datapath($writedir);
-  $sbe->generate_database({ file => $dbpath, description => $parent->id});
-  #Run vmatch on everything in the array
-  $sbe->search
-  ({
-    database            => "$rand.FASTA",
-    query_file          => $datapath,
-    complete            => 1,
-    mismatches          => $mismatches,
-    direct_and_rev_com  => 1,
-    online              => 1}
-  );
-  my %hits = map {$_->id => 0} @$seqarrs;
-  while ( my $res = $sbe->next_res )
-  {
-    $hits{$res->query->id}++;
-  }
-  #Clean up and return
-  system "rm $writedir$rand.FASTA.*" || croak ("Can't clean up? $!");
-  system "rm $dbpath" || croak ("Can't clean up? $!");
-  system "rm $datapath" || croak ("Can't clean up? $!");
-  my @cleans = grep {$hits{$_->id} == 1} @$seqarrs;
-  return \@cleans;
-=head2 _search_vmatch()
-sub _search_vmatch
-  my ($parent, $seq, $mismatches, $revcom, $writedir) = @_;
-  my $rand = md5_hex(md5_hex(time().{}.rand().$$));
-  my $band = md5_hex(md5_hex(time().{}.rand().$$));
-  #Write the parent to a FASTA file
-  my $dbpath = $writedir . "$rand.FASTA";
-  open (my $POUT, '>', $dbpath) || croak($!);
-  print $POUT q{>} . $parent->id . "\n" . $parent->seq . "\n";
-  close $POUT;
-  #Write the queries to a FASTA file
-  my $datapath = $writedir . "$band.FASTA";
-  open (my $DOUT, '>', $datapath) || croak($!);
-  print $DOUT q{>} . $seq->id . "\n" . $seq->seq . "\n";
-  close $DOUT;
-  #Make the vmatch database
-  my $sbe = Bio::Grep->new('Vmatch');
-  $sbe->settings->datapath($writedir);
-  $sbe->generate_database
-  (
-    {
-      file => $dbpath,
-      description => $parent->id
-    }
-  );
-  #Run vmatch on everything in the array
-  $sbe->search
-  (
-    {
-      database            => "$rand.FASTA",
-      query_file          => $datapath,
-      complete            => 1,
-      mismatches          => $mismatches,
-      direct_and_rev_com  => 1,
-      online              => 1
-    }
-  );
-  my @hits;
-  while ( my $res = $sbe->next_res )
-  {
-    push @hits, $res->sequence();
-  }
-  #Clean up and return
-  system "rm $writedir$rand.FASTA.*" || croak ("Can't clean up? $!");
-  system "rm $dbpath" || croak ("Can't clean up? $!");
-  system "rm $datapath" || croak ("Can't clean up? $!");
-  return \@hits;
-Copyright (c) 2012, GeneDesign developers
-All rights reserved.
-Redistribution and use in source and binary forms, with or without modification,
-are permitted provided that the following conditions are met:
-* Redistributions of source code must retain the above copyright notice, this
-list of conditions and the following disclaimer.
-* Redistributions in binary form must reproduce the above copyright notice, this
-list of conditions and the following disclaimer in the documentation and/or
-other materials provided with the distribution.
-* The names of Johns Hopkins, the Joint Genome Institute, the Lawrence Berkeley
-National Laboratory, the Department of Energy, and the GeneDesign developers may
-not be used to endorse or promote products derived from this software without
-specific prior written permission.

File stubs/CodonsOld.pm

View file
 =head1 VERSION
-Version 5.00
+Version 5.50
 use strict;
 use warnings;
-our $VERSION = 5.00;
+our $VERSION = 5.50;
 use base qw(Exporter);
 our @EXPORT_OK = qw(
-Copyright (c) 2012, GeneDesign developers
+Copyright (c) 2013, GeneDesign developers
 All rights reserved.
 Redistribution and use in source and binary forms, with or without modification,

File stubs/GD_Swap_Codons.pl

View file
 use strict;
 use warnings;
-my $VERSION = '5.00';
+my $VERSION = '5.50';
 my $GDV = "GD_Swap_Codons_$VERSION";
 my $GDS = "_CJ";
 =head1 VERSION
-  Version 5.00
+  Version 5.50
-Copyright (c) 2012, GeneDesign developers
+Copyright (c) 2013, GeneDesign developers
 All rights reserved.
 Redistribution and use in source and binary forms, with or without modification,

File stubs/HTML.pm

View file
-Copyright (c) 2012, GeneDesign developers
+Copyright (c) 2013, GeneDesign developers
 All rights reserved.
 Redistribution and use in source and binary forms, with or without modification,

File stubs/SufTree copy.pm

View file
 =head1 VERSION
-Version 5.00
+Version 5.50
 use strict;
 use warnings;
-my $VERSION = 5.00;
+my $VERSION = 5.50;
 =head1 Functions
-Copyright (c) 2012, GeneDesign developers
+Copyright (c) 2013, GeneDesign developers
 All rights reserved.
 Redistribution and use in source and binary forms, with or without modification,

File t/00-load.t

View file
 #!perl -T
-use Test::More tests => 16;
+use Test::More tests => 11;
 use strict;
 use warnings;
   use_ok( 'Bio::GeneDesign::Codons' )       || print "Can't use Codons\n";
   use_ok( 'Bio::GeneDesign::CodonJuggle' )  || print "Can't use CodonJuggle\n";
   use_ok( 'Bio::GeneDesign::Oligo' )        || print "Can't use Oligo\n";
-  use_ok( 'Bio::GeneDesign::Oligos::JGI' )  || print "Can't use Oligos::JGI\n";
-  use_ok( 'Bio::GeneDesign::Oligos::JHU' )  || print "Can't use Oligos::JHU\n";
   use_ok( 'Bio::GeneDesign::Random' )       || print "Can't use Random\n";
   use_ok( 'Bio::GeneDesign::PrefixTree' )   || print "Can't use PrefixTree\n";
   use_ok( 'Bio::GeneDesign::Exceptions' )   || print "Can't use Exceptions\n";
-  use_ok( 'Bio::GeneDesign::Vector' )       || print "Can't use Vector\n";
   use_ok( 'Bio::GeneDesign::RestrictionEnzyme' )
       || print "Can't use RestrictionEnzyme\n";
   use_ok( 'Bio::GeneDesign::ReverseTranslate' )
       || print "Can't use ReverseTranslate\n";
-  use_ok( 'Bio::GeneDesign::BuildingBlocks::enzyme' )
-      || print "Can't use BuildingBlocks::enzyme\n";
-  use_ok( 'Bio::GeneDesign::BuildingBlocks::overlap' )
-      || print "Can't use BuildingBlocks::overlap\n";

File t/45-palindrome.t

-#! /usr/bin/perl
-#FAILS 25 IF perl -T
-use Test::More;
-use Bio::GeneDesign;
-use Bio::Seq;
-use strict;
-use warnings;
-eval {require Bio::Factory::EMBOSS};
-    plan skip_all => 'Bio::Factory::EMBOSS not installed';
-    plan tests => 1;
-my $GD = Bio::GeneDesign->new();
-$GD->set_organism(-organism_name => "yeast",
-                  -table_path => "codon_tables/Standard.ct",
-                  -rscu_path => "codon_tables/yeast.rscu");
-my $pal = Bio::Seq->new( -seq => "ATAACTTCGTATAATGTACATTATACGAAGTTAT", -id => "loxPsym");
-my $nopal = Bio::Seq->new( -seq => "ACATTATACGAAGTTAT", -id => "halfloxPsym");
-my $rarr = [$nopal];
-my $tarr = $GD->filter_palindromes(-sequences => [$pal, $nopal]);
-is_deeply ($tarr, $rarr, "filter palindromes");

File t/50-vmatch.t

-#! /usr/bin/perl
-#FAILS 255 IF perl -T
-use Test::More;
-use Bio::GeneDesign;
-use Bio::Seq;
-use strict;
-use warnings;
-my $GD = Bio::GeneDesign->new();
-unless ($GD->vmatch)
-    plan skip_all => 'Vmatch support not installed';
-    plan tests => 1;
-$seq .= "ATT";
-my $seqobj = Bio::Seq->new( -seq => $seq, -id => "Dicot_A5.05");
-my $rhsh = {