Commits

Sarah Richardson  committed 3cadc5a

to fix fails during testing when GeneDesign has never been installed

  • Participants
  • Parent commits 7db6b81

Comments (0)

Files changed (3)

File t/30-enzymes.t

                   -table_path => "codon_tables/Standard.ct",
                   -rscu_path => "codon_tables/yeast.rscu");
 
+$GD->{conf} = 'blib/GeneDesign/';
 $GD->set_restriction_enzymes(-list_path => "enzymes/test");
 
 my $orf = "ATGGACAGATCTTGGAAGCAGAAGCTGAACCGCGACACCGTGAAGCTGACCGAGGTGATGACCTGGA";

File t/35-subtract_sequence.t

                   -table_path => "codon_tables/Standard.ct",
                   -rscu_path => "codon_tables/yeast.rscu");
 
+$GD->{conf} = 'blib/GeneDesign/';
 # TESTING subtract_sequence sequence
 if (1)
 {

File t/60-prefix.t

                   -table_path => "codon_tables/Standard.ct",
                   -rscu_path => "codon_tables/yeast.rscu");
 
+$GD->{conf} = 'blib/GeneDesign/';
 $GD->set_restriction_enzymes(-list_path => "enzymes/test");
 
 my %elist = (RsaI => 1, TaqI => 1, BsrI => 1, AciI => 1);