Source

biostuff / pyfasta / tests / data / three_chrs.fasta

Full commit

>chr1
ACTGACTGACTGACTGACTGACTGACTGACTGACTGA
CTGACTGACTGACTGACTGACT
GACTGACTGACTGACTGACTG

>chr2
TAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAT




>chr3
ACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATT
ACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATT
ACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATT
ACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATT
ACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATT
ACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATT
ACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATT
ACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATT
ACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATT
ACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATT
ACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTACACGCATTACGCACGCTAC