Issue #73 resolved

ePCR not working

Gary Schindelman
created an issue

ePCR is not working on the dev or live site. on live site get the following:

NOT FOUND: assay_1

<font color="red">Couldn't run e-PCR program: </font>

on dev site get:

NOT FOUND: assay_1

used the example assay_1 CGATAAACAATCAACGGCATAAT TTTGAAACTGATATAGAGGGGCA 1188

Comments (2)

  1. Log in to comment