- edited description
Not getting the same result as the site output
Issue #3
new
I’m trying to get a large number of Sgrnas and Offtargets from chopchop, all my targets are fasta so I made this fasta file, ex:
>@MN01025:40:000H2WKF7:1:11101:8293:1033 2:N:0:56
GGGATGATGTTCTGGAGAGCCCCGCGGCCATCACGCCACAGTTTCCCGGAGGGGCCATCCACAGTCTTCTGGGTGGCAGTGATGGCATGGACTGTGGTCATGAGTCCTTCCACGATACCAAAGTTGTCATGGATGACCTTGGCCAGGGGTG
And run the command:
chopchop.py -J -P -T 1 -M NGG \
-g 20 -scoringMethod DOENCH_2016 -f NN -BB AGGCTAGTCCGT \
-G hg38 -t CODING -n N \
-R 4 -3 "PRODUCT_SIZE_MIN=150,PRODUCT_SIZE_MAX=290,PRIMER_MIN_SIZE=18,PRIMER_MAX_SIZE=25,PRIMER_OPT_SIZE=22,PRIMER_MIN_TM=57,PRIMER_MAX_TM=63,PRIMER_OPT_TM=60" \
-A 290 -a 20 -o tests/chopchop_output_fasta -Target target_test.fa -F \
-BED -GenBank -filterGCmin 10 -filterGCmax 90 -rm1perfOff \
-DF 300 -v 3 -repairPredictions mESC
I got all the opt from query.json of the site.
Rank Target sequence Genomic location Strand GC content (%) Self-complementarity MM0 MM1 MM2 MM3 Efficiency
1 GACAACTTTGGTATCGTGGAAGG @MN01025:9 11101 45 0 179 210 257 609 0.00
Traceback (most recent call last):
File "chopchop.py", line 3394, in <module>
main()
File "chopchop.py", line 3302, in main
seqvis = FastaToViscoords(sequences, strand)
File "chopchop.py", line 2211, in FastaToViscoords
exonend.append(exoncoord[1])
IndexError: list index out of rang
I have downloaded everything from the site and done everything mentioned in the readme.md. What Am I Doing WRONG?!!!
Comments (2)
-
reporter -
reporter I also found out that the problem is with fasta input and genomic position targets are fine
- Log in to comment