Commits

Anonymous committed 859a230

Import from CVS: tag r19-15b93

Comments (0)

Files changed (185)

 							-*- indented-text -*-
+to 19.15 beta93
+-- VM-6.13 Courtesy of Kyle Jones
+-- Custom-1.30
+-- Replicating extents are history
+-- tm-7.103.5
+-- Miscellaneous bug fixes
+-- Synch to 20.0 patches
+
 to 19.15 beta92
 -- gnus-5.4.11
 -- tm-7.103.1
   ;;
 
   ## Data General AViiON Machines
+  i586-dg-dgux5.4R4* | i586-dg-dgux5.4.4* )
+    machine=aviion opsys=dgux5-4r4
+  ;;
   m88k-dg-dgux5.4R3* | m88k-dg-dgux5.4.3* )
     machine=aviion opsys=dgux5-4r3
   ;;

etc/gnus/gnus-group-subscribe-up.xbm

Added
New image
+#define noname_width 32
+#define noname_height 32
+static char noname_bits[] = {
+ 0x08,0x04,0x00,0x40,0x22,0x51,0x55,0x15,0x88,0x04,0x00,0x20,0x22,0xa0,0xaa,
+ 0x4a,0xc4,0xff,0x3f,0x00,0x61,0x80,0x60,0x55,0x54,0x8a,0xa0,0x80,0x42,0x84,
+ 0x20,0x2b,0x68,0x8a,0xe0,0x83,0x42,0x80,0x00,0x2a,0xd4,0xff,0x00,0x42,0x41,
+ 0x80,0x00,0x16,0x54,0x8a,0x00,0x42,0x41,0x84,0x00,0x2a,0x54,0x8a,0x00,0x82,
+ 0x41,0x80,0x00,0x2a,0xd4,0xff,0x00,0x82,0x42,0x80,0x00,0x2a,0x68,0x8a,0x00,
+ 0x82,0x44,0x84,0x00,0x2a,0x52,0x8a,0x00,0x42,0x40,0x80,0x00,0x16,0xea,0xff,
+ 0x00,0x22,0x40,0x80,0x00,0x4a,0x4a,0x80,0x00,0x02,0x61,0x80,0x00,0x56,0x44,
+ 0x80,0x00,0x02,0x51,0x80,0x00,0x52,0xc4,0xff,0xff,0x0b,0xa1,0x04,0x00,0x42,
+ 0x14,0xa8,0xaa,0x88,0x82,0x02,0x00,0x22};

etc/gnus/gnus-group-subscribe-up.xpm

Added
New image
+/* XPM */
+static char * icon-unsubscribe_xpm[] = {
+"32 32 3 1",
+" 	c #BFBFBFBFBFBF s backgroundToolBarColor",
+".	c #000000000000",
+"X	c #FFFFFFFFFFFF",
+"                                ",
+"                                ",
+"                                ",
+"                                ",
+"      ................          ",
+"      .XXXXXXXX.XXXXX..         ",
+"      .XX.X.XXX.XXXXX.X.        ",
+"      .XXX.XXXX.XXXXX.XX.       ",
+"      .XX.X.XXX.XXXXX.....      ",
+"      .XXXXXXXX.XXXXXXXXX.      ",
+"      ..........XXXXXXXXX.      ",
+"      .XXXXXXXX.XXXXXXXXX.      ",
+"      .XX.X.XXX.XXXXXXXXX.      ",
+"      .XXX.XXXX.XXXXXXXXX.      ",
+"      .XX.X.XXX.XXXXXXXXX.      ",
+"      .XXXXXXXX.XXXXXXXXX.      ",
+"      ..........XXXXXXXXX.      ",
+"      .XXXXXXXX.XXXXXXXXX.      ",
+"      .XX.X.XXX.XXXXXXXXX.      ",
+"      .XXX.XXXX.XXXXXXXXX.      ",
+"      .XX.X.XXX.XXXXXXXXX.      ",
+"      .XXXXXXXX.XXXXXXXXX.      ",
+"      ..........XXXXXXXXX.      ",
+"      .XXXXXXXX.XXXXXXXXX.      ",
+"      .XXXXXXXX.XXXXXXXXX.      ",
+"      .XXXXXXXX.XXXXXXXXX.      ",
+"      .XXXXXXXX.XXXXXXXXX.      ",
+"      .XXXXXXXX.XXXXXXXXX.      ",
+"      ....................      ",
+"                                ",
+"                                ",
+"                                "};

etc/gnus/gnus-group-unsubscribe-up.xbm

Added
New image
+#define noname_width 32
+#define noname_height 32
+static char noname_bits[] = {
+ 0x08,0x04,0x00,0x40,0x22,0x51,0x55,0x15,0x88,0x04,0x00,0x20,0x22,0xa0,0xaa,
+ 0x4a,0xc4,0xff,0x3f,0x00,0x61,0x80,0x60,0x55,0x54,0xa0,0xa0,0x80,0x42,0x90,
+ 0x20,0x2b,0x68,0x8a,0xe0,0x83,0x42,0x84,0x00,0x2a,0xd4,0xff,0x00,0x42,0x41,
+ 0x80,0x00,0x16,0x54,0xa0,0x00,0x42,0x41,0x90,0x00,0x2a,0x54,0x8a,0x00,0x82,
+ 0x41,0x84,0x00,0x2a,0xd4,0xff,0x00,0x82,0x42,0x80,0x00,0x2a,0x68,0xa0,0x00,
+ 0x82,0x44,0x90,0x00,0x2a,0x52,0x8a,0x00,0x42,0x40,0x84,0x00,0x16,0xea,0xff,
+ 0x00,0x22,0x40,0x80,0x00,0x4a,0x4a,0x80,0x00,0x02,0x61,0x80,0x00,0x56,0x44,
+ 0x80,0x00,0x02,0x51,0x80,0x00,0x52,0xc4,0xff,0xff,0x0b,0xa1,0x04,0x00,0x42,
+ 0x14,0xa8,0xaa,0x88,0x82,0x02,0x00,0x22};

etc/gnus/gnus-group-unsubscribe-up.xpm

Added
New image
+/* XPM */
+static char * icon-subscribe_xpm[] = {
+"32 32 3 1",
+" 	c #BFBFBFBFBFBF s backgroundToolBarColor",
+".	c #000000000000",
+"X	c #FFFFFFFFFFFF",
+"                                ",
+"                                ",
+"                                ",
+"                                ",
+"      ................          ",
+"      .XXXXXXXX.XXXXX..         ",
+"      .XXXXXX.X.XXXXX.X.        ",
+"      .XXXXX.XX.XXXXX.XX.       ",
+"      .XX.X.XXX.XXXXX.....      ",
+"      .XXX.XXXX.XXXXXXXXX.      ",
+"      ..........XXXXXXXXX.      ",
+"      .XXXXXXXX.XXXXXXXXX.      ",
+"      .XXXXXX.X.XXXXXXXXX.      ",
+"      .XXXXX.XX.XXXXXXXXX.      ",
+"      .XX.X.XXX.XXXXXXXXX.      ",
+"      .XXX.XXXX.XXXXXXXXX.      ",
+"      ..........XXXXXXXXX.      ",
+"      .XXXXXXXX.XXXXXXXXX.      ",
+"      .XXXXXX.X.XXXXXXXXX.      ",
+"      .XXXXX.XX.XXXXXXXXX.      ",
+"      .XX.X.XXX.XXXXXXXXX.      ",
+"      .XXX.XXXX.XXXXXXXXX.      ",
+"      ..........XXXXXXXXX.      ",
+"      .XXXXXXXX.XXXXXXXXX.      ",
+"      .XXXXXXXX.XXXXXXXXX.      ",
+"      .XXXXXXXX.XXXXXXXXX.      ",
+"      .XXXXXXXX.XXXXXXXXX.      ",
+"      .XXXXXXXX.XXXXXXXXX.      ",
+"      ....................      ",
+"                                ",
+"                                ",
+"                                "};

etc/gnus/gnus-pointer.xbm

Added
New image
+#define noname_width 18
+#define noname_height 13
+static char noname_bits[] = {
+ 0x00,0x00,0x00,0xc0,0x0c,0x00,0xe0,0x1f,0x00,0x92,0x39,0x00,0x0e,0x71,0x02,
+ 0x46,0xe0,0x03,0x20,0xc0,0x01,0x00,0x08,0x00,0x10,0x0d,0x00,0xc4,0x08,0x00,
+ 0x78,0x08,0x00,0x18,0x89,0x00,0x00,0x08,0x00};

etc/gnus/gnus-summary-catchup-up.xbm

Added
New image
+#define noname_width 32
+#define noname_height 32
+static char noname_bits[] = {
+ 0x11,0x91,0x11,0x95,0x54,0x25,0x54,0x21,0x02,0x90,0x00,0x84,0xa0,0x0a,0x54,
+ 0x29,0x1b,0xb1,0x11,0x91,0x40,0x0a,0x4a,0x25,0x8a,0xa0,0x20,0x88,0x20,0x14,
+ 0x0e,0x22,0x9b,0x51,0xb7,0x99,0x20,0x14,0x0b,0x02,0x42,0xc1,0x22,0x28,0x14,
+ 0x92,0x48,0x45,0x51,0x19,0x11,0x11,0x14,0x42,0xaa,0x54,0x42,0x88,0x00,0x02,
+ 0x90,0x72,0xaa,0x56,0x15,0x71,0x11,0x17,0x42,0x3a,0x49,0x4b,0x28,0x49,0xa4,
+ 0x22,0x04,0x30,0x02,0x09,0xb1,0xdb,0x59,0xb5,0x15,0xa0,0xd3,0xff,0x40,0x05,
+ 0xbf,0x02,0x2a,0xd3,0x08,0x54,0x91,0x53,0x77,0x7f,0xc8,0xa9,0xd4,0x8a,0x62,
+ 0x22,0x86,0x35,0xc8,0x5b,0x4b,0x67,0x93,0xfd,0x91,0x39,0x24,0x18,0xff,0x7a,
+ 0x90,0x46,0xc5,0xcf,0x25,0x94,0x21,0xf1};

etc/gnus/gnus-summary-catchup-up.xpm

Added
New image
+/* XPM */
+static char * icon-catchup2_xpm[] = {
+"32 32 2 1",
+" 	c #000000000000",
+".	c #BFBFBFBFBFBF s backgroundToolBarColor",
+" ... ... ... ... ... ... ... ...",
+"................................",
+"................................",
+"................................",
+" ... ... ... ... ... ... ... ...",
+"................................",
+"................................",
+".................  .............",
+" ... ... ... ...   . ... ... ...",
+"................  ..............",
+"............... ................",
+"................................",
+" ... ... ... ... ... ... ... ...",
+"................................",
+"................................",
+".............  ..........  .....",
+" ... ... ...   . ... ...   . ...",
+"............  ..........  ......",
+"........... ........... ........",
+"............  .......... .......",
+" ... ... ... . . ... ... ... ...",
+"...............  .....          ",
+"................      ... ......",
+"........  ..... ... ...... .....",
+" ... ..   .. . . . .  .. .     .",
+".......  .... .... ... .. . ... ",
+"...... ...... ... .....  ... ...",
+"......    .. .... ......   .. ..",
+" ... ... .       ... ..  ..   ..",
+"........... ....      . ....   .",
+".......... ..... .....      .. .",
+".......... ..... ....... ...    "};
Old
Old image
New
New image
 "64 42 6 1",
 "X  	c Gray75 s backgroundToolBarColor",
 "i	c Gray20",
-"@	c yellow",
+"@	c rgb:00/df/ff",
 "T	c red",
 "t	c pink",
 "o	c black",

etc/vm/mime-colorful-dn.xpm

Added
New image
+/* XPM */
+static char *mime-colorful-dn[] = {
+/* width height num_colors chars_per_pixel */
+"    64    42       88            2",
+/* colors */
+".. c #878787",
+".# c #818181",
+".a c #7f7f7f",
+".b c #939393",
+".c c #969696",
+".d c #979797",
+".e c #9f9f9f",
+".f c #a7a7a7",
+".g c #a1a1a1",
+".h c #a5a5a5",
+".i c #aeaeae",
+".j c #adadad",
+".k c #959595",
+".l c #9a9a9a",
+".m c #939393",
+".n c #868686",
+".o c #828282",
+".p c #8b8b8b",
+".q c #a3a3a3",
+".r c #838383",
+".s c #8e8e8e",
+".t c #a2a2a2",
+".u c #7d7d7d",
+".v c #7b7b7b",
+".w c #797979",
+".x c #767676",
+".y c #757575",
+".z c #757575",
+".A c #777777",
+".B c #727272",
+".C c #6f6f6f",
+".D c #6a6a6a",
+".E c #636363",
+".F c #6b6b6b",
+".G c #8a8a8a",
+".H c #8e8e8e",
+".I c #676767",
+".J c #6e6e6e",
+".K c #7a7a7a",
+".L c #626262",
+".M c #7e7e7e",
+".N c #8d8d8d",
+".O c #565656",
+".P c #505050",
+".Q c #4d4d4d",
+".R c #494949",
+".S c #434343",
+".T c #404040",
+".U c #575757",
+".V c #393939",
+".W c #3d3d3d",
+".X c #3f3f3f",
+".Y c #4f4f4f",
+".Z c #585858",
+".0 c #5b5b5b",
+".1 c #5a5a5a",
+".2 c #858585",
+".3 c #5e5e5e",
+".4 c #4b4b4b",
+".5 c #7b7b7b",
+".6 c #3a3a3a",
+".7 c #636363",
+".8 c #444444",
+".9 c #3c3c3c",
+"#. c #353535",
+"## c #515151",
+"#a c #323232",
+"#b c #6c6c6c",
+"#c c #6a6a6a",
+"#d c #6f6f6f",
+"#e c #2a2a2a",
+"#f c #666666",
+"#g c #838383",
+"#h c #2d2d2d",
+"#i c #737373",
+"#j c #8f8f8f",
+"#k c #6c6c6c",
+"#l c #a3a3a3",
+"#m c #9f9f9f",
+"#n c Gray60",
+"#o c #969696",
+"#p c #b0b0b0",
+"#q c #ababab",
+"#r c #9e9e9e",
+"#s c #9a9a9a",
+"#t c #8a8a8a",
+"#u c Gray60",
+"#v c #a7a7a7",
+/* pixels */
+"...#.#.......a.a.#.....b.b.c.d.d.d.e.d.e.e.e.e.e.e.f.g.g.h.h.e.f.h.i.h.h.f.h.h.f.h.j.j.f.h.f.j.f.h.j.h.j.h.g.e.e.e.d.d.k.c.l.b.m",
+".b.n...........o...p.b.b.b.b.c.d.d.e.c.d.e.e.e.d.g.e.e.e.g.l.g.e.e.g.g.e.g.q.f.h.h.h.g.h.h.h.j.i.h.h.h.h.e.e.e.e.l.e.c.d.e.c.m.c",
+".r.r...#...........b.b.b.s.b.m.d.d.c.l.e.d.l.e.d.e.m.d.l.d.e.e.e.e.e.e.e.e.d.g.d.e.e.e.h.g.f.h.h.h.h.f.h.g.t.e.e.d.e.d.c.c.d.c.c",
+".#.o.a.#.#.#...#.......p...b.b.b.m.k.d.b.d.d.m.b.b.d.d.b.b.b.m.k.d.d.d.d.d.b.m.k.d.d.d.d.g.g.g.e.e.g.e.g.e.e.d.d.d.d.d.b.k.b.b.d",
+".s.......#.#.#...#.o.#.....#.....p.....p.......#.a.#.#.......#.............b.b.b...b.b.k.e.c.e.d.e.d.e.d.e.e.d.d.k.c.b.b.m.b.m.d",
+".#.#.o.r.a.u.a.u.o.u.u.u.a.#.o.u.u.r.u.u.u.v.u.w.w.x.u.u.u.u.u.u.a.#.o.#.o.............s.s.b.k.k.k.b.k.b.m.b.b.s.......s...b.s.b",
+"...a.u.u.w.u.u.y.w.z.z.u.u.u.z.u.w.z.y.z.z.u.z.z.z.z.z.y.u.w.u.z.#.a.u.#.a.#.#.#...#.....#...........p.b.b...#.o.o.a.o.o.#.s.s.s",
+".a.w.z.u.w.z.w.w.w.z.A.u.z.z.z.B.z.z.A.z.A.z.A.y.z.C.A.z.z.y.w.w.w.a.o.a.#.#.o.a.o...o...#...#.#.#.#.r.#.#...o.a.a.o.u.a.o.o.#..",
+".#.o.u.z.z.z.z.B.B.z.y.B.z.B.B.B.B.B.B.B.B.B.B.B.C.B.B.w.w.w.w.x.u.w.u.u.o...a...#.....#.#...n.#.#.#.n...#.#.o.#.#.....#.o.r.#.#",
+".w.a.w.w.B.B.B.z.B.B.z.B.B.D.C.B.C.B.B.C.D.C.E.C.C.F.z.B.B.B.w.B.u.u.u.u.u.#.#.#.....G.......H...#.#.#.........#.....H..........",
+".w.x.z.z.B.B.z.C.z.B.B.B.C.C.D.C.E.I.C.E.E.D.D.C.B.F.B.B.F.z.w.w.w.u.#.v.o.a...........G...G...b.s.H.s.H.....G.s.H...G.b.s......",
+".w.x.z.B.B.z.A.z.B.B.B.F.C.B.F.E.C.E.E.C.E.F.E.B.J.B.B.B.w.w.w.w.w.o.u.#.o.#.#...n.#.....s...p.s.b...b.b...G.b...G.b...p.b...G..",
+".w.w.w.x.B.#.B.w.B.F.B.B.F.D.B.D.B.D.D.I.F.E.C.D.B.B.F.z.z.z.B.w.z.w.o.K.u.#.o.w.o.n...#.G.....H.b...s.G.b.b.s.H.p.b.b.s...G...#",
+".u.w.w.w.w.w.w.K.u.z.B.B.B.F.B.B.C.D.C.E.F.L.E.L.L.I.E.F.C.C.B.F.B.C.C.z.z.u.M.w.a.o.a.#.....H...s.G.b.b.N...b.....p...s.G.N...#",
+".a.w.a.w.a.o.a.u.y.w.B.B.B.B.C.E.L.O.P.P.Q.R.S.S.T.Q.R.R.R.P.P.U.O.L.L.L.E.B.F.B.B.x.w.M.w.#.o.o.#.#.......s.....s.s.G...s......",
+".#...o...o.r.a.#.u.u.B.C.F.E.P.U.R.V.P.R.V.W.T.V.V.X.S.S.T.Q.R.P.Y.Z.0.1.Z.1.L.1.E.L.B.B.B.x.w.w.o.2...#...G...#.n.s...G.....#..",
+".....#...#.o.r.a.w.w.B.F.3.P.Z.4.R.R.Q.V.S.S.T.W.V.S.V.S.V.S.S.W.R.P.Z.U.L.0.0.L.0.U.L.E.F.C.z.w.a.5.#.#.o.#...#...n.o.#...o....",
+".........#.o.a.o.x.x.C.O.Z.U.R.Y.R.R.R.W.W.S.S.W.W.V.6.6.W.S.W.W.R.S.W.R.S.R.P.Z.L.L.L.0.0.0.7.F.B.x.w.w.K.o.o.o.o...n.....n....",
+".s.H.......o.a.w.x.F.U.Z.U.Y.P.R.Y.R.S.S.8.R.6.S.S.6.S.W.6.9.9.9.9#..9#..6.S.R.Y.U.Z.P##.L.L.0.L.0.F.F.B.x.x.M.o.5...n.n.o...G..",
+".b.s.H...#.n.K.x.F.1.L.L.P.P.4.Y.R.8.Z.Y.L.Z.V.W.R.S.W#..9#.#..6.S.8.8.W.6.W.R.R.R.R.R.Z.L.L.F.L.L.U.0.F.F.M.w.M.o.n.2...o......",
+".s.s...n.#.o.w.F.L.L.L.1.L.L.U.Z.Z.Z.Z.5.7.R.S.S.R.S.9#a.9#.#.#b#b#c.Z.R.W.S.S.Y.R.Y.R.Y.Y.U.7.L.L.F.L.E.F.F.M.M.w.M.o.n.....G.s",
+".s.G.....o.K.M.1.F.F.E.F.L.L.Z#d.o.K.n.n.7.Z.Z.Y.S.W#a#e#a#e.6#d#d.5#b.R.8.S.Y#d.Z.R.R.R.8.Z.Z.U.7.F.B#d.C.B.x.A.#.o.a...G.H.b.k",
+".s.N.G...o.5.B.F.C.C.3.F.F#f#d.n.K.o.n#g#c.Z.Z.Z.S.6#.#e#h#..8#d.5#g.5.Z.8.Y.U.5.5#c.Y.Y.Y.R.Y.L.L.F.F.B.x.F.A.x.5..#g.....b.k.k",
+".H.s...n.o.w.C.F.B.C.C.F#f.M.o#g.n.n.H.G.5#d.U.Y.Y.6#.#a#.#..6#d#b.5#d.Z.Y.Z.7#g.n.5#d.Z.R.Y.Y.P.L.7.F.F.B.o.K.#.o.n...G.H.b.H.d",
+".s.H.....#.w.B.B#i.F#d.B.o.n.n.H.H.n.H#j.5.Z.Z.Z.L.U.Z.Y.6#..W.7#d.7#d.Z.7.7#d.H#j.H.G.5.Z.U.4.Z.Z.L.L#k.A.w.5.o.....G.m.b.k.b.k",
+".s.H...n.#.w.w.x.B.z.B.5.5.n#g.n.n.H#j.H#g#c.L.L#d#d#d.7.Y.R.W.Y.7#d.7.Y.Z#c.n#l#m.G#m.H.A.7.F.L.0.L.C.A.B.F.o.....G.b.H.k.d.d.g",
+".k.H.....n.#.o.w#n#n#n#n#n.n.n.n.H#m.k#o.H.5#c#c#b#b#c#d#d#d#d.7#b#b#d#c#d#d#p#q#l#n#n.5.A.x.M.M.A.A#d.F#d.#.N.G.b.k.k.k.d.g.k.g",
+".b.H.G...n.#.o.5#n#n.B.x#n#n.n.H.k#r.k.t.t.H#d#c#b#b#d#d#c.5#d#d#d#d#d#b#d#l#p.t#q#n#n.M.M.M.M.M.M.o.G.H.G.H.b.k.k.k.d.g#s.d.g#m",
+".H.k.H.H...o.n#n#n.B.B.B#n#n.n.G#n#n#n#n.t#m#g#n#n#n#n#d#d#d#n#n#n#n#d#d#r#n#n#l#n#n.5.5#n#n#n#n.M.5.n.b.k.k.k.k.g.b#m.b.g.g.g.k",
+".d#m.b.k.#.o.o#n#n.x.B.B#n#n.n#n#n.k#l#n#n#p#n#n#d#d#n#n#d#n#n#d#b#n#n.k#n#n#q#n#n#n.n#n#n.M.M#n.o.n.s.G.b.k.g.k.b#m.k.g.g#r.g.k",
+".b.k.b.k...o#n#n.o.w.B.B#n#n#n#n.G.k#r#n#n#n#n#r.5.5#b#d#n#n#b#d#d#n#n#n#n#p#r.H#n#n#n#n.M.A#g#n.o.n.H.H.d#m.d.g.g.g.g.g.e.g.g.g",
+".k.d.g.k.H.o#n#n.w.B.w#n#n.M#n#n#n#n#n#n#r#n#n#l.t#m.H#g#n#n.5.H#n#n#p#n#n#m.G#n#n#t#n#n#n#n#n#n.H.k.H.k.d.g#m.g.g.g.g.g.h.g.g.g",
+".g.e.d.d.H.o#n#n.x.w.w#n#n#n#n.o#g.n.o#g#n#n.s#m#r#n#n#n#n#m#m#u#u#n#n#n#m.G#u#u#n#u#u.n#u#u.n.n.H.H.k#u#u.e#u#u#u#u#u.g.h.h.f.h",
+".e.k.g.k.b#n#n.M.M.M#n#n.5#n#n.a.o#n#n.n#n#n.G.H#n#n.s#n#n.H.H#u#u#u#n#n.N#u#u#u#j#u#u.N#u#u#u.H.H.b#u#u#u.g#u#u.h.h.g#q.h#q.h.h",
+".e#m.d.d.b#n#n#n#n#n#n.o.w.M#n#n#n#n.w.5.##n#n#n#n.H.H.G#n#n#n#u#u#u.G#n#n#u#u#u.H#u#u#n#u#u#u.k.k.H#u#u#u.g#u#u.g.h.h.h.h.i.h.g",
+".d.g.g.k.d.k.p.s...#...n.5.5.#.5.M.A.M.#.5.o...5.n.G...n#g.G#g#u#u#u#u.n#u#u#u#u.k#u#u.b#u#u#u#u.g#u#u#u#u.h#u#u#u#u#u.h#v.f.f#q",
+".g.g.g.g.d.d.b.G.H...G.....n.o.o.A.o.s.M.#.n.5.o.o.n.o#g.x.n.n#u#u.b#u.G#u.k#u#u.H#u#u.g#u#u.g#u.g#u.h#u#u.i#u#u.i.g.i.f.i.g.h.i",
+".g.t.g.g.d.e.k.b.H.H.G.H.G.....5.o.n.o.5...5.G.o.n.....G.M.G..#u#u.d#u#u#u#m#u#u.k#u#u.g#u#u.g#u#u#u.h#u#u.h#u#u.h#q.f#q.h.i.h.j",
+".t.h.h.g.g#r.d.d.H.s.H.b.H.H.G.G.......n.G...G.n.G.H.H.H.n.H.H#u#u.g#m#u.g#m#u#u#r#u#u#r#u#u.h#q#u#q.h#u#u.i#u#u#q.h#q.h.i#q.i.h",
+".g.t.h.g.g.g.k.d.k.b.H.b.H.k.b.H.G.s.n.H.G.H.H.s.H.k.d.k.s.H.H#u#u#m#m#u#s#m#u#u#m#u#u#m#u#u#q.g#u.g#q#u#u.i#u#u#u#u#u#q.h.i.h#q",
+".h.h#v.h.g.g.g#m.d.d.k.d.k.k.k.d.H.k.G.s.H.b.b.k.b.d.b.H.e#m.H.k.g#m#m.g#r.g.g#q.g.h#q.h#q.g#q.h#q#q.h.i.i.h.i.i.i.i.h.i.h.i.h.f",
+".g.g.h.f.h.g.g.e.d.g.b.k.d.k.b.k.k.k.d.b.b.k.k.k.d.d.d.g.k.g.k.g#r.g.g.g.t.g.h#q#m.h#v#q.h#q.h#q#q#q.i#q.i.h.h#q.h.i.h.i.h.f.i.h"
+};

etc/vm/mime-colorful-up.xpm

Added
New image
+/* XPM */
+static char * mime-fancy-up_xpm[] = {
+"64 42 88 1",
+" 	c #B8B878785050",
+".	c #B0B070705050",
+"X	c #B0B070704848",
+"o	c #C8C880806060",
+"O	c #C8C888885858",
+"+	c #C8C888886060",
+"@	c #D0D090906868",
+"#	c #D8D898987070",
+"$	c #D0D090907070",
+"%	c #D0D098987070",
+"&	c #D8D8A0A08080",
+"*	c #D8D8A0A07878",
+"=	c #C0C088886060",
+"-	c #D0D088886060",
+";	c #C0C088885858",
+":	c #B0B078785858",
+">	c #B0B070705858",
+",	c #C0C078785858",
+"<	c #D0D098986868",
+"1	c #B8B870705050",
+"2	c #C0C080805050",
+"3	c #C8C898987070",
+"4	c #A8A870704848",
+"5	c #B0B068684848",
+"6	c #A8A868684848",
+"7	c #A0A068684848",
+"8	c #A8A860604848",
+"9	c #A0A068684040",
+"0	c #A0A068685050",
+"q	c #A0A060604848",
+"w	c #989860604848",
+"e	c #989858584040",
+"r	c #909050504040",
+"t	c #909060604040",
+"y	c #B8B878786060",
+"u	c #B8B880806060",
+"i	c #909058584040",
+"p	c #989860604040",
+"a	c #A0A070704848",
+"s	c #808058584040",
+"d	c #A8A870705050",
+"f	c #B8B880805858",
+"g	c #787848483838",
+"h	c #686848483838",
+"j	c #686840404040",
+"k	c #606040403838",
+"l	c #585838383838",
+"z	c #505038383838",
+"x	c #787848484040",
+"c	c #484830303838",
+"v	c #484838383838",
+"b	c #505038383030",
+"n	c #606048484040",
+"m	c #707050504040",
+"M	c #787850504040",
+"N	c #808048484040",
+"B	c #B0B078785050",
+"V	c #808050504040",
+"C	c #606040404040",
+"Z	c #A0A070705050",
+"A	c #404038383838",
+"S	c #808058584848",
+"D	c #505040403838",
+"F	c #484838383030",
+"G	c #404030303030",
+"H	c #686848484040",
+"J	c #383830303030",
+"K	c #808068685050",
+"L	c #888860604848",
+"P	c #888868685050",
+"I	c #303028282828",
+"U	c #888858584848",
+"Y	c #A8A878785858",
+"T	c #383828282828",
+"R	c #989868684848",
+"E	c #B8B880806868",
+"W	c #909060604848",
+"Q	c #C8C898987878",
+"!	c #C8C890907878",
+"~	c #FFFFFFFFFFFF",
+"^	c #C0C088886868",
+"/	c #D0D0A8A88888",
+"(	c #D0D0A0A08080",
+")	c #C8C890907070",
+"_	c #C8C888887070",
+"`	c #B0B080805858",
+"'	c #000000000000",
+"]	c #D0D098988080",
+" ..   XX.  ooO+++@+@@@@@@#$$%%@#%&%%#%%#%**#%#*#%*%*%$@@@++=O-o;",
+"o:     > ,ooooO++@O+@@@+$@@@$-$@@$$@$<#%%%$%%%*&%%%%@@@@-@O+@O;O",
+"11 .     ooo2o;++O-@+-@+@;+-+@@@@@@@@+$+@@@%$#%%%%#%$3@@+@+OO+OO",
+".>X... .   , ooo;=+o++;oo++ooo;=+++++o;=++++$$$@@$@$@@+++++o=oo+",
+"2   ... .>.  .  ,  ,   .X..   .      ooo oo=@O@+@+@+@@++=Ooo;o;+",
+"..>1X4X4>444X.>44144454667444444X.>.>      22o===o=o;oo2   2 o2o",
+" X446448699444946989949999984649.X4.X... .  .     ,oo .>>X>>.222",
+"X69469666904999q990909089w0998666X>X..>X> > . ....1.. >XX>4X>>. ",
+".>49999qq98q9qqqqqqqqqqqwqq666674644> X .  .. :...: ..>..  .>1..",
+"6X66qqq9qq9qqewqwqqwewrwwt9qqq6q44444...  y   u ...    .  u     ",
+"6799qq9w9qqqwwewriwrreewqtqqt96664.5>X     y y o2u2u  y2u yo2   ",
+"679qq909qqqtwqtrwrrwrtrqpqqq66666>4.>.. :.  2 ,2o oo yo yo ,o y ",
+"6667q.q6qtqqteqeqeeitrweqqt999q696>a4.>6>: .y  uo 2yoo2u,oo2 y .",
+"4666666a49qqqtqqwewrtsrssirtwwqtqww994d6X>X.  u 2yoof o  , 2yf .",
+"X6X6X>X486qqqqwrsghhjkllzjkkkhhxgsssrqtqq76d6.>>..   2  22y 2   ",
+". > >1X.44qwtrhxkchkcvzccbllzjkhnmMNmNsNrsqqq766>B . y .:2 y  . ",
+"  . .>1X66qtVhmCkkjcllzvclclcllvkhmxsMMsMxsrtw96XZ..>. . :>. >  ",
+"    .>X>77wgmxknkkkvvllvvcAAvlvvklvklkhmsssMMMStq766a>>>> :  :  ",
+"2u   >X67txmxnhknkllDkAllAlvAFFFFGFGAlknxmhHssMsMttq77d>Z ::> y ",
+"o2u .:a7tNsshhCnkDmnsmcvklvGFGGAlDDvAvkkkkkmsstssxMttd6d>:B >   ",
+"22 :.>6tsssNssxmmmmZSkllklFJFGGKKLmkvllnknknnxSsstsrttdd6d>:  y2",
+"2y  >adNttrtssmP>a::SmmnlvJIJIAPPZKkDlnPmkkkDmmxStqPwq70.>X yuo=",
+"2fy >ZqtwwVttUP:a>:YLmmmlAGITGDPZYZmDnxZZLnnnknssttq7t07Z Y  o==",
+"u2 :>6wtqwwtUd>Y::uyZPxnnAGJGGAPKZPmnmSY:ZPmknnhsSttq>a.>: yuou+",
+"2u  .6qqRtPq>::uu:uEZmmmsxmnAGvSPSPmSSPuEuyZmxCmmssW06Z>  y;o=o=",
+"2u :.667q9qZZ:Y::uEuYLssPPPSnkvnSPSnmL:Q!y!u0StsMsw0qt>  you=++$",
+"=u  :.>6~~~~~:::u!=^uZLLKKLPPPPSKKPLPP/(Q~~Z07dd00PtP.fyo===+$=$",
+"ouy :.>Z~~q7~~:u=)=33uPLKKPPLZPPPPPKPQ/3(~~dddddd>yuyuo===+$_+$!",
+"u=uu >:~~qqq~~:y~~~~3!Y~~~~PPP~~~~PP)~~Q~~ZZ~~~~dZ:o====$o!o$$$=",
+"+!o=.>>~~7qq~~:~~=Q~~/~~PP~~P~~PK~~=~~(~~~:~~dd~>:2yo=$=o!=$$)$=",
+"o=o= >~~>6qq~~~~y=)~~~~)ZZKP~~KPP~~~~/)u~~~~d0Y~>:uu+!+$$$$$@$$$",
+"=+$=u>~~6q6~~d~~~~~~)~~Q3!uY~~Zu~~/~~!y~~`~~~~~~u=u=+$!$$$$$%$$$",
+"$@++u>~~766~~~~>Y:>Y~~2!)~~~~!!''~~~!y''~'':''::uu=''@'''''$%%#%",
+"@=$=o~~ddd~~Z~~X>~~:~~yu~~2~~uu'''~~f'''E''f'''uuo'''$''%%$(%(%%",
+"@!++o~~~~~~>6d~~~~6Z.~~~~uuy~~~'''y~~'''u''~'''==u'''$''$%%%%&%$",
+"+$$=+=,2 . :ZZ.Zd0d.Z> Z:y :YyY'''':''''=''o''''$''''%'''''%]##(",
+"$$$$++oyu y  :>>0>2d.:Z>>:>Y7::''o'y'=''u''$''$'$'%''&''&$&#&$%&",
+"$3$$+@=ouuyuy  Z>:>Z Zy>:  ydy ''+'''!''=''$''$'''%''%''%(#(%&%*",
+"3%%$$)++u2uouuyy   :y y:yuuu:uu''$!'$!'')'')''%('(%''&''(%(%&(&%",
+"$3%$$$=+=ouou=ouy2:uyuu2u=+=2uu''!!'_!''!''!''($'$(''&'''''(%&%(",
+"%%]%$$$!++=+===+u=y2uoo=o+ou@!u=$!!$)$$($%(%($(%((%&&%&&&&%&%&%#",
+"$$%#%$$@+$o=+=o===+oo===+++$=$=$)$$$3$%(!%](%(%(((&(&%%(%&%&%#&%"};

etc/vm/mime-colorful-xx.xpm

Added
New image
+/* XPM */
+static char * mime-fancy-up_xpm[] = {
+"64 42 89 1",
+" 	c #B8B878785050",
+".	c #B0B070705050",
+"X	c #B0B070704848",
+"o	c #C8C880806060",
+"O	c #C8C888885858",
+"+	c #C8C888886060",
+"@	c #D0D090906868",
+"#	c #D8D898987070",
+"$	c #D0D090907070",
+"%	c #D0D098987070",
+"&	c #D8D8A0A08080",
+"*	c #D8D8A0A07878",
+"=	c #C0C088886060",
+"-	c #D0D088886060",
+";	c #C0C088885858",
+":	c #B0B078785858",
+">	c #B0B070705858",
+",	c #C0C078785858",
+"<	c #D0D098986868",
+"1	c #B8B870705050",
+"2	c #C0C080805050",
+"3	c #C8C898987070",
+"4	c #A8A870704848",
+"5	c #B0B068684848",
+"6	c #A8A868684848",
+"7	c #A0A068684848",
+"8	c #A8A860604848",
+"9	c #A0A068684040",
+"0	c #A0A068685050",
+"q	c #A0A060604848",
+"w	c #989860604848",
+"e	c #989858584040",
+"r	c #909050504040",
+"t	c #909060604040",
+"y	c #B8B878786060",
+"u	c #B8B880806060",
+"i	c #909058584040",
+"p	c #989860604040",
+"a	c #A0A070704848",
+"s	c #808058584040",
+"d	c #A8A870705050",
+"f	c #B8B880805858",
+"g	c #787848483838",
+"h	c #686848483838",
+"j	c #686840404040",
+"k	c #606040403838",
+"l	c #585838383838",
+"z	c #505038383838",
+"x	c #787848484040",
+"c	c #484830303838",
+"v	c #484838383838",
+"b	c #505038383030",
+"n	c #606048484040",
+"m	c #707050504040",
+"M	c #787850504040",
+"N	c #808048484040",
+"B	c #B0B078785050",
+"V	c #808050504040",
+"C	c #606040404040",
+"Z	c #A0A070705050",
+"A	c #404038383838",
+"S	c #808058584848",
+"D	c #505040403838",
+"F	c #484838383030",
+"G	c #404030303030",
+"H	c #686848484040",
+"J	c #383830303030",
+"K	c #808068685050",
+"L	c #888860604848",
+"P	c #888868685050",
+"I	c #303028282828",
+"U	c #888858584848",
+"Y	c #A8A878785858",
+"T	c #383828282828",
+"R	c #989868684848",
+"E	c #B8B880806868",
+"W	c #909060604848",
+"Q	c #C8C898987878",
+"!	c #C8C890907878",
+"~	c Gray60",
+"^	c #C0C088886868",
+"/	c #D0D0A8A88888",
+"(	c #D0D0A0A08080",
+")	c #C8C890907070",
+"_	c #C8C888887070",
+"`	c #B0B080805858",
+"'	c Gray60",
+"]	c #D0D098988080",
+"[	c black s backgroundToolBarColor",
+" [.[ [X[.[ [o[+[+[+[@[@[@[$[%[@[%[%[#[%[%[*[%[*[%[%[%[@[@[+[O[o[",
+"[:[ [ [>[,[o[o[+[@[+[@[+[@[@[-[@[$[@[<[%[%[%[%[&[%[%[@[@[@[+[O[O",
+"1[ [ [ [ [o[2[;[+[-[+[@[@[+[+[@[@[@[@[$[@[@[$[%[%[#[$[@[+[+[O[O[",
+"[>[.[.[.[ [,[o[o[=[o[+[o[+[o[o[=[+[+[o[=[+[+[$[@[$[$[@[+[+[o[o[+",
+"2[ [.[.[.[.[ [ [,[ [ [ [X[.[ [.[ [ [ [o[ [o[@[@[@[@[@[+[=[o[;[;[",
+"[.[1[4[4[4[4[.[4[1[4[5[6[7[4[4[4[.[.[ [ [ [2[o[=[o[o[o[2[ [2[o[o",
+" [4[6[4[6[9[4[9[6[8[9[9[9[9[4[4[.[4[X[.[ [ [.[ [ [,[o[.[>[>[.[2[",
+"[6[4[9[6[9[4[9[q[9[9[9[8[w[9[8[6[X[X[.[X[ [ [ [.[.[.[ [X[>[X[>[ ",
+".[4[9[9[q[8[9[q[q[q[q[q[w[q[6[6[4[4[>[X[.[ [.[:[.[:[.[>[.[ [>[.[",
+"[X[6[q[9[q[q[e[q[q[w[w[w[t[q[q[q[4[4[.[.[ [ [ [ [.[ [ [.[ [ [ [ ",
+"6[9[q[9[9[q[w[e[r[w[r[e[q[q[t[6[6[.[>[ [ [ [ [ [2[2[ [y[u[y[2[ [",
+"[7[q[9[9[q[t[q[r[r[w[t[q[q[q[6[6[>[.[.[ [.[ [ [2[ [o[y[ [o[,[ [ ",
+"6[6[q[q[q[q[t[q[q[e[t[w[q[t[9[q[9[>[4[>[>[ [y[ [o[2[o[2[,[o[ [ [",
+"[6[6[6[a[9[q[t[q[e[r[s[s[i[t[w[t[w[9[4[6[>[.[ [ [y[o[ [ [,[2[f[.",
+"X[X[X[X[8[q[q[w[s[h[j[l[z[k[k[h[g[s[r[t[q[6[6[>[.[ [ [ [2[y[2[ [",
+"[ [ [1[.[4[w[r[x[c[k[v[c[b[l[j[h[m[N[N[N[s[q[7[6[B[.[y[.[2[y[ [ ",
+" [.[.[1[6[q[V[m[k[j[l[z[c[c[c[l[k[m[s[M[M[s[t[9[X[.[>[ [ [>[ [ [",
+"[ [ [>[>[7[g[x[n[k[v[l[v[c[A[l[v[l[k[k[m[s[M[M[t[7[6[>[>[ [ [:[ ",
+"2[ [ [X[7[x[x[h[n[l[D[A[l[l[A[F[F[F[A[k[x[h[s[M[M[t[7[d[Z[:[>[y[",
+"[2[ [:[7[N[s[h[n[D[n[m[v[l[G[G[A[D[v[v[k[k[m[s[s[x[t[d[d[:[ [ [ ",
+"2[ [.[6[s[s[s[x[m[m[S[l[k[F[F[G[K[m[v[l[k[k[n[S[s[s[t[d[6[>[ [y[",
+"[y[ [a[N[t[t[s[P[a[:[m[n[v[I[I[P[Z[k[l[P[k[k[m[x[t[P[q[0[>[ [u[=",
+"2[y[>[q[w[V[t[P[a[:[L[m[l[G[T[D[Z[Z[D[x[Z[n[n[n[s[t[7[0[Z[Y[ [=[",
+"[2[:[6[t[w[t[d[Y[:[y[P[n[A[J[G[P[Z[m[m[Y[Z[m[n[h[S[t[>[.[:[y[o[+",
+"2[ [.[q[R[P[>[:[u[u[Z[m[s[m[A[v[P[P[S[P[E[y[m[C[m[s[0[Z[ [y[o[o[",
+"[u[:[6[7[9[Z[:[:[u[u[L[s[P[S[k[n[P[n[L[Q[y[u[S[s[s[0[t[ [y[u[+[$",
+"=[ [:[>[~[~[~[:[u[=[u[L[K[L[P[P[K[P[P[/[Q[~[0[d[0[P[P[f[o[=[+[=[",
+"[u[ [.[Z[~[7[~[u[)[3[u[L[K[P[Z[P[P[K[Q[3[~[d[d[d[>[u[u[=[=[$[+[!",
+"u[u[ [:[~[q[~[:[~[~[3[Y[~[~[P[~[~[P[)[~[~[Z[~[~[d[:[=[=[$[![$[$[",
+"[![=[>[~[7[q[~[~[=[~[/[~[P[~[~[P[~[=[~[~[~[~[d[~[:[y[=[=[![$[)[=",
+"o[o[ [~[>[q[~[~[y[)[~[~[Z[K[~[K[P[~[~[)[~[~[d[Y[>[u[+[+[$[$[@[$[",
+"[+[=[>[~[q[~[d[~[~[~[~[Q[![Y[~[u[~[~[![~[`[~[~[~[=[=[$[$[$[$[$[$",
+"$[+[u[~[7[6[~[~[Y[>[~[2[)[~[~[!['[~[!['[~['['[:[u[=['['['['[%[#[",
+"[=[=[~[d[d[~[~[X[~[:[~[u[~[~[u['['[~['['['[f['[u[o['[$['[%[([([%",
+"@[+[o[~[~[~[6[~[~[6[.[~[~[u[~[~['[y[~['[u['['['[=['['['[$[%[%[%[",
+"[$[=[=[2[.[:[Z[Z[0[.[>[Z[y[:[y['['[:['['['[o['['['['[%['['[%[#[(",
+"$[$[+[o[u[y[ [>[0[2[.[Z[>[>[7[:['['['['[u['['[$[$[%['['[&[&[&[%[",
+"[3[$[@[o[u[u[ [Z[:[Z[Z[>[ [y[y['[+['[!['['[$['['['['[%['[([([&[*",
+"3[%[$[+[u[u[u[y[ [ [y[y[y[u[:[u['[![$['[)['['[%['[%['['[([([&[&[",
+"[3[$[$[+[o[o[=[u[2[u[u[2[=[=[u['[!['[!['['[!['[$[$['[&['['[([&[(",
+"%[][$[$[+[=[=[=[u[y[u[o[o[o[@[u[$[![)[$[$[([([([([%[&[&[&[%[%[%[",
+"[$[#[$[@[$[=[=[=[=[o[=[=[+[$[$[$[$[$[$[([%[([([([([([%[([&[&[#[%"};
Added
New image
+#define e_width 64
+#define e_height 42
+static char e_bits[] = {
+ 0x39,0xfe,0xff,0xff,0xff,0xff,0xff,0xff,0xff,0xff,0xff,0xff,0xff,0xff,0xff,
+ 0xff,0xf7,0xff,0xff,0xff,0xff,0xff,0xff,0xff,0x42,0xff,0xff,0xff,0xff,0xff,
+ 0xff,0xff,0x8f,0xda,0x7f,0xb8,0xff,0xff,0xff,0xff,0x0c,0x41,0x02,0x00,0xf4,
+ 0xff,0xff,0xff,0x01,0x00,0x00,0x00,0x00,0xed,0xbf,0xed,0x00,0x00,0x00,0x00,
+ 0x44,0x2f,0x64,0xb2,0x02,0x00,0x00,0x00,0xb0,0x66,0x4c,0x36,0x00,0x00,0x00,
+ 0x00,0x00,0xff,0x78,0xff,0x00,0x00,0x00,0x00,0xd0,0xff,0xff,0xff,0x00,0x00,
+ 0x00,0x00,0x92,0xfd,0xff,0xff,0x00,0x00,0x00,0x00,0x44,0xf7,0xff,0x7f,0x00,
+ 0x00,0x00,0x00,0x00,0xf2,0xff,0x7f,0x20,0x00,0x00,0x00,0x00,0xc0,0xfc,0xff,
+ 0x3e,0x00,0x00,0x00,0x00,0x00,0x77,0xbf,0x6b,0x00,0x00,0x00,0x00,0x00,0x50,
+ 0xf7,0xaf,0x00,0x00,0x00,0x00,0x00,0xe0,0xff,0x3f,0x00,0x00,0x00,0x0a,0x00,
+ 0x80,0xfe,0x2f,0x00,0x00,0x68,0x00,0x00,0x00,0xff,0x2f,0x00,0x00,0x68,0x00,
+ 0x00,0x00,0xfc,0x1f,0x00,0x0d,0x3c,0x00,0x00,0x00,0xfa,0x1f,0x80,0x0e,0x3c,
+ 0x02,0x00,0x00,0xfe,0x1f,0xc0,0x0f,0x3c,0x80,0x01,0x20,0xff,0x0f,0xf0,0x0f,
+ 0x20,0x80,0x07,0x80,0xff,0x0f,0xe0,0x1f,0x00,0xc0,0x0f,0xc0,0xff,0x5f,0xff,
+ 0x1f,0x00,0xc0,0x07,0xc0,0xff,0x5f,0xf3,0x3f,0x00,0xe0,0x07,0xfe,0xff,0xff,
+ 0xf1,0xff,0xc7,0xf3,0xf3,0xfc,0xff,0xef,0xf1,0xff,0x6c,0xfe,0x9f,0xff,0xff,
+ 0xff,0xf1,0xff,0x30,0xfe,0xcf,0xff,0xff,0xff,0xd8,0xff,0xbf,0xff,0xff,0xff,
+ 0xff,0xff,0xf8,0xff,0x7f,0x3e,0xc9,0x27,0xf8,0x7f,0x6c,0xff,0x7f,0x1c,0x89,
+ 0x23,0xff,0xff,0xcf,0xe3,0x7f,0x1c,0x89,0x23,0xff,0xff,0x0d,0x60,0x7f,0x08,
+ 0x09,0x21,0xf8,0xff,0xff,0xa6,0x6f,0x2a,0x49,0x25,0xff,0xff,0x7f,0xd7,0x6f,
+ 0x22,0x49,0x24,0xff,0xff,0xff,0xff,0x7f,0x36,0xc9,0x26,0xff,0xff,0xff,0xff,
+ 0x7f,0x36,0xc9,0x26,0xf8,0xff,0xff,0xff,0xff,0xff,0xff,0xff,0xff,0xff,0xff,
+ 0xff,0xff,0xff,0xff,0xff,0xff};

etc/vm/mime-simple-dn.xpm

Added
New image
+/* XPM */
+static char *noname[] = {
+/* width height ncolors chars_per_pixel */
+"64 42 8 1",
+/* colors */
+"` c Gray60",
+"a c #666666666666",
+"b c #9A9A9A9A9A9A",
+"c c #B0B0B0B0B0B0",
+"d c #2A2A2A2A2A2A",
+"e c #878787878787",
+"f c Gray60",
+"g c #434343434343",
+/* pixels */
+"eeeeeeeeeeebbbbbbbbbbbbbbcbbccbccccccccccccccccccccccbbbbbbbbbbb",
+"beeeeeeeeebbbbbbbbbbbbbbbbbbbbbbbbbbbbccccbcccccccccbbbbbbbbbbbb",
+"eeeeeeeeebbbebbbbbbbbbbbbbbbbbbbbbbbbbbbbbbcbcccccccbbbbbbbbbbbb",
+"eeeeeeeeeeeeebbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbb",
+"eeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeebbbebbbbbbbbbbbbbbbbbbbbbbb",
+"eeeeeeeeeeeeeeeeeeeeeeeeeaeeeeeeeeeeeeeeeeeeebbbbbbbbbbeeeeeebeb",
+"eeeeeeeaeaaeeeaeeaaaaeaaaaaaeeeaeeeeeeeeeeeeeeeeeeebbeeeeeeeeeee",
+"eeaeeaeeeaeeaaaaaaeaeaeaaaeaaaeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee",
+"eeeaaaaaaaaaaaaaaaaaaaaaaaaeeeeaeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee",
+"eeeeaaaaaaaaaaaaaaaaaaaaaaaaaaeaeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee",
+"eaaaaaaaaaaaaaaaaaaaaaaaaaaaaaeeeeeeeeeeeeeeeeebeeeeeeeeeeebeeee",
+"eaaaaaeaaaaaaaaaaaaaaaaaaaaaeeeeeeeeeeeeeeeeeeeebebbeebeebeebeee",
+"eeeaaeaeaaaaaaaaaaaaaaaaaaaaaaaeaeeeeeeeeeeeeeeebeeebbeeebbeeeee",
+"eeeeeeeeeaaaaaaaaaaaaaaaaaaaaaaaaaaaaeeeeeeeeeeeeebbeebeeeeeeeee",
+"eeeeeeeeaeaaaaaaaagggggggggggggaaaaaaaaaaaeeeeeeeeeeeeeeeeeeeeee",
+"eeeeeeeeeeaaaagagggggggggggggggggaaaaaaaaaaaaaeeeeeeeeeeeeeeeeee",
+"eeeeeeeeeeaaagagggggggggggggggggggaaaaaaaaaaaaaeeeeeeeeeeeeeeeee",
+"eeeeeeeeaaaaaagggggggggggggggggggggggggaaaaaaaaaaaeeeeeeeeeeeeee",
+"eeeeeeeeaaaaaggggggggggggggggggggdgdggggaaggaaaaaaaaaaeeeeeeeeee",
+"beeeeeeaaaaaggggggagaagggggdgddggggggggggggaaaaaaaaaaeeeeeeeeeee",
+"eeeeeeeaaaaaaaaaaaaeaggggggdgddaaaaggggggggggaaaaaaaaaeeeeeeeeee",
+"eeeeeeeaaaaaaaaaeeeeaaagggddddgaaeaggggaaggggaaaaaaaaaaeeeeeeebb",
+"eeeeeeaaaaaaaaaeeeeeaaaaggddddgaeeeaggaeeagggggaaaaaaaeaeeeeebbb",
+"eeeeeeaaaaaaaeeeeeeeeaagggddddgaaeaagaaeeeaaggggaaaaaeeeeeeeebeb",
+"eeeeeeaaaaaaeeeeeeeeeaaaaaaggdgaaaaaaaaeeeeeaagaaaaaeeeeeeebbbbb",
+"eeeeeeeaaaaeeeeeeeeeeaaaaaaaggggaaagaaebbebeeaaaaaaeaaeeeebebbbb",
+"beeeeeeefffffeeeebbbeeaaaaaaaaaaaaaaaaccbffeeaeeeeaaaeeebbbbbbbb",
+"beeeeeeeffaaffeebbbbbeaaaaaaaeaaaaaaabcbcffeeeeeeeeeeebbbbbbbbbb",
+"ebeeeeeffaaaffeeffffbbeffffaaaffffaabffbffeeffffeeebbbbbbbbbbbbb",
+"bbbbeeeffaaaffeffbbffcffaaffaffaaffbffcfffeffeefeeeebbbbbbbbbbbb",
+"bbbbeeffeeaaffffebbffffbeeaaffaaaffffcbeffffeeefeeeebbbbbbbbbbbb",
+"bbbbeeffeaeffeffffffbffbbbeeffeeffcffbeffeffffffebebbbbbbbbbcbbb",
+"bbbbeeffaeeffffeeeeeffebbffffbb``fffbe``f``e``eeeeb``b`````bcccc",
+"bbbbbffeeeffeffeeffeffeeffeffee```ffe```e``e```eeb```b``ccbccccc",
+"bbbbbffffffeeeffffeeeffffeeefff```eff```e``f```bbe```b``bccccccb",
+"bbbbbbeeeeeeeeeeeeeeeeeeeeeeeee````e````b``b````b````c`````ccccc",
+"bbbbbbbeeeeeeeeeeeeeeeeeeeeeaee``b`e`b``e``b``b`b`c``c``cbcccbcc",
+"bbbbbbbbeeeeeeeeeeeeeeeeeeeeeee``b```b``b``b``b```c``c``cccccccc",
+"bccbbbbbeeebeeeeeeeeeeeeeeeeeee``bb`bb``b``b``cc`cc``c``cccccccc",
+"bbcbbbbbbbebebbeeeeeeeeeebbbeee``bb`bb``b``b``cb`bc``c`````ccccc",
+"ccccbbbbbbbbbbbbebeeebbbbbbebbebbbbbbbbcbccccbcccccccccccccccccc",
+"bbcccbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbccbccccccccccccccccccccccc"
+};

etc/vm/mime-simple-up.xpm

Added
New image
+/* XPM */
+static char *noname[] = {
+/* width height ncolors chars_per_pixel */
+"64 42 8 1",
+/* colors */
+"` c #000000000000",
+"a c #B8B878785050",
+"b c #D0D0A8A88888",
+"c c #585838383838",
+"d c #303028282828",
+"e c #FFFFFFFFFFFF",
+"f c #D0D090906868",
+"g c #909050504040",
+/* pixels */
+"aaaaaaaaaaaffffffffffffffffffffffbfffffffbbfffbffbfbfffffffffffa",
+"faaaaaaaaaffffffffffffffffffffffffffffffffffffbbffffffffffffffaf",
+"aaaaaaaaafffafaffffffffffaffffffffffffffffffffffffffffffffffffff",
+"aaaaaaaaaaaaafffafffffafffffffafffffffafffffffffffffffffffffffff",
+"aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaafffafffffffffffffffffffafaf",
+"aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaafffffffaffaaaaaafaf",
+"aaaaaaaaaggaaagaagaggagggggaaaagaaaaaaaaaaaaaaaaaaaffaaaaaaaaaaa",
+"aagaagaaagaaggggggagagaaggaggaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa",
+"aaagggggggaggggggggggggggggaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa",
+"aaaaggggggggggggggggggggggggggagaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa",
+"aaggggggggggggggggggggggggggggaaaaaaaaaaaaaaaaafaaaaaaaaaaafaaaa",
+"aaggggagggggggggggggggggggggaaaaaaaaaaaaaaaaaaaafaffaafaafaafaaa",
+"aaaagagagggggggggggggggggggggggagaaaaaaaaaaaaaaafaaaffaaaffaaaaa",
+"aaaaaaaaaggggggggggggggggggggggggggggaaaaaaaaaaaaaffaafaaaaaaaaa",
+"aaaaaaaaaaggggggggcccccccccccccggggggggggaaaaaaaaaaaaaaaaaaaaaaa",
+"aaaaaaaaaaggggcgcccccccccccccccccggggggggggggaaaaaaaaaaaaaaaaaaa",
+"aaaaaaaaaagggcgcccccccccccccccccccgggggggggggggaaaaaaaaaaaaaaaaa",
+"aaaaaaaaaaggggcccccccccccccccccccccccccggggggggggaaaaaaaaaaaaaaa",
+"aaaaaaaaaggggccccccccccccccccccccdcdccccggccggggggggaaaaaaaaaaaa",
+"faaaaaaaggggccccccgcggcccccdcddccccccccccccggggggggggaaaaaaaaaaa",
+"aaaaaaaggggggggggggagccccccdcddggggccccccccccgggggggggaaaaaaaaaa",
+"aaaaaaagggggggggaaaagggcccddddcggagccccggccccgggggggggaaaaaaaaff",
+"aaaaaagggggggggaaaaaggggccddddcgaaagccgaagcccccgggggagaaaaaaafff",
+"aaaaaagggggggaaaaaaaaggcccddddcggaggcggaaaggccccgggggaaaaaaaafaf",
+"aaaaaaggggggaaaaaaaaaggggggccdcggggggggaaaaaggcgggggaaaaaaaaffff",
+"aaaaaaaagggaaaaaaaaaagggggggccccgggcggaffafaaggggggaggaaaafaffff",
+"faaaaaaaeeeeeaaaafffaaggggggggggggggggbbfeeaaaaaaagggaaaffffffff",
+"faaaaaaaeegaeeaafffffagggggggagggggggfbfbeeaaaaaaaaaaaffffffffff",
+"afaaaaaeegggeeaaeeeeffaeeeegggeeeeggfeefeeaaeeeeaaafffffffffffff",
+"ffffaaaeeaggeeaeeffeebeeggeegeeggeefeebeeeaeeaaeaaaaffffffffffff",
+"ffffaaeeaaggeeeeaffeeeefaaggeegggeeeebfaeeeeaaaeaaaaffffffffffff",
+"ffffaaeeagaeeaeeeeeefeefffaaeeaaeebeefaeeaeeeeeeafafffffffffffff",
+"ffffaaeeaaaeeeeaaaaaeeaffeeeeff``eeefa``e``a``aaaaf``f`````fffff",
+"fffffeeaaaeeaeeaaeeaeeaaeeaeeaa```eea```a``a```aaf```f``fffbfbff",
+"fffffeeeeeeaaaeeeeaaaeeeeaaaeee```aee```a``e```ffa```f``fffffbff",
+"ffffffaaaaaaaaaaaaaaaaaaaaaaaaa````a````f``f````f````f`````fbffb",
+"fffffffaaaaaaaaaaaaaaaaaaaaaaaa``f`a`f``a``f``f`f`f``b``bfbfbffb",
+"ffffffffaaaaaaaaaaaaaaaaaaaaaaa``f```f``f``f``f```f``f``fbfbfbfb",
+"ffffffffaaafaaaaaaaaaaaaaaaaaaa``ff`ff``f``f``fb`bf``b``bfbfbbbf",
+"ffffffffffafaffaaaaaaaaaafffaaa``ff`ff``f``f``bf`fb``b`````bfbfb",
+"ffbfffffffffffffafaaaffffffaffaffffffffbffbfbfbfbbfbbfbbbbfbfbff",
+"fffffffffffffffffffffffffffffffffffffffbffbbfbfbbbbbbffbfbfbffbf"
+};

etc/vm/mime-simple-xx.xpm

Added
New image
+/* XPM */
+static char *noname[] = {
+/* width height ncolors chars_per_pixel */
+"64 42 8 1",
+/* colors */
+"` c #000000000000",
+"a c #D0D0A8A88888",
+"b c #B8B870705050",
+"c c #888868685050",
+"d c #999999999999",
+"e c #505040403838",
+"f c #303028282828",
+"g c #787848483838",
+/* pixels */
+"b`b`b`b`b`b`b`b`b`b`a`a`a`a`a`a`a`a`a`a`a`a`a`a`a`a`a`a`a`b`b`b`",
+"`b`b`b`b`b`b`b`b`a`b`a`b`a`a`b`a`a`a`a`a`a`a`a`a`a`a`a`a`a`b`b`b",
+"b`b`b`b`b`b`b`b`b`b`b`a`a`b`b`a`a`a`a`a`a`a`a`a`a`a`a`a`b`b`b`b`",
+"`b`b`b`b`b`b`b`b`b`b`b`b`b`b`b`b`b`b`b`b`b`b`a`a`a`a`a`b`b`b`b`b",
+"b`b`b`b`b`b`b`b`b`b`b`b`b`b`b`b`b`b`b`b`b`b`a`a`a`a`a`b`b`b`b`b`",
+"`b`b`b`b`b`b`b`b`b`b`b`b`c`b`b`b`b`b`b`b`b`b`b`b`b`b`b`b`b`b`b`b",
+"b`b`b`b`b`c`b`c`b`b`c`c`c`c`b`b`b`b`b`b`b`b`b`b`b`b`b`b`b`b`b`b`",
+"`b`b`c`b`c`b`c`c`c`c`c`b`c`c`b`b`b`b`b`b`b`b`b`b`b`b`b`b`b`b`b`b",
+"b`b`c`c`c`b`c`c`c`c`c`c`c`c`b`b`b`b`b`b`b`b`b`b`b`b`b`b`b`b`b`b`",
+"`b`b`c`c`c`c`c`c`c`c`c`c`c`c`c`c`b`b`b`b`b`b`b`b`b`b`b`b`b`b`b`b",
+"b`c`c`c`c`c`c`c`g`c`g`c`c`c`c`b`b`b`b`b`b`b`b`b`b`b`b`b`b`b`b`b`",
+"`c`c`c`c`c`c`c`g`g`c`c`c`c`c`b`b`b`b`b`b`b`b`b`b`b`b`b`b`b`b`b`b",
+"b`b`c`c`c`c`c`c`c`c`c`c`c`c`c`c`c`b`b`b`b`b`b`b`b`b`b`b`b`b`b`b`",
+"`b`b`b`b`c`c`c`c`c`g`g`g`c`c`c`c`c`c`b`b`b`b`b`b`b`b`b`b`b`b`b`b",
+"b`b`b`b`b`c`c`c`g`g`g`e`e`e`e`g`g`g`g`c`c`b`b`b`b`b`b`b`b`b`b`b`",
+"`b`b`b`b`b`c`g`g`e`e`e`e`e`e`g`g`g`g`g`g`g`c`c`b`b`b`b`b`b`b`b`b",
+"b`b`b`b`b`c`g`g`e`g`e`e`e`e`e`e`e`g`g`g`g`g`c`c`b`b`b`b`b`b`b`b`",
+"`b`b`b`b`c`g`g`e`e`e`e`e`e`e`e`e`e`e`e`g`g`g`g`c`c`b`b`b`b`b`b`b",
+"b`b`b`b`c`g`g`g`e`e`e`e`e`e`e`e`e`e`e`e`g`g`g`g`g`c`c`b`b`b`b`b`",
+"`b`b`b`c`g`g`g`e`e`e`g`e`e`f`f`e`e`e`e`e`e`g`g`g`g`c`b`b`b`b`b`b",
+"b`b`b`b`g`g`g`g`g`g`c`e`e`e`e`f`c`g`e`e`e`e`e`c`g`g`c`b`b`b`b`b`",
+"`b`b`b`g`c`c`g`c`b`b`g`e`e`f`f`c`b`e`e`c`e`e`g`g`c`c`c`c`b`b`b`b",
+"b`b`b`c`c`g`c`c`b`b`c`g`e`f`f`e`b`b`e`g`b`e`e`e`g`c`c`c`b`b`b`b`",
+"`b`b`b`c`c`c`b`b`b`b`c`e`e`f`f`c`b`g`g`b`b`g`e`g`c`c`b`b`b`b`b`b",
+"b`b`b`c`c`c`b`b`b`b`b`g`g`g`e`e`c`c`c`c`b`b`g`e`g`g`c`b`b`b`b`b`",
+"`b`b`b`c`c`b`b`b`b`b`c`g`c`c`e`e`c`e`c`a`b`b`c`g`g`c`c`b`b`b`b`a",
+"b`b`b`b`d`d`d`b`b`b`b`c`c`c`c`c`c`c`c`a`a`d`c`b`c`c`c`b`b`b`b`b`",
+"`b`b`b`b`d`c`d`b`a`a`b`c`c`c`b`c`c`c`a`a`d`b`b`b`b`b`b`b`b`a`b`a",
+"b`b`b`b`d`c`d`b`d`d`a`b`d`d`c`d`d`c`a`d`d`b`d`d`b`b`b`b`a`a`a`a`",
+"`a`b`b`d`c`c`d`d`b`d`a`d`c`d`d`c`d`b`d`d`d`d`b`d`b`b`b`b`a`a`a`b",
+"b`b`b`d`b`c`d`d`b`a`d`d`b`c`d`c`c`d`d`a`d`d`b`b`b`b`b`b`a`a`a`a`",
+"`b`b`b`d`c`d`b`d`d`d`d`a`a`b`d`b`d`d`a`d`b`d`d`d`b`b`a`a`a`a`a`a",
+"a`b`b`d`c`b`d`d`b`b`d`b`a`d`d`a`d`d`a`d`d`d`d`b`b`b`d`d`d`d`a`a`",
+"`b`b`d`b`b`d`d`b`d`b`d`b`d`d`b`d`d`d`d`d`d`b`d`b`b`d`a`d`a`a`a`a",
+"a`b`b`d`d`d`b`d`d`b`b`d`d`b`d`d`d`b`d`d`b`d`d`d`b`d`d`d`a`a`a`a`",
+"`a`b`b`b`b`b`b`b`c`b`b`b`b`b`b`d`d`b`d`d`d`b`d`d`d`d`a`d`d`a`a`a",
+"a`a`b`b`b`b`b`b`c`b`b`b`b`b`c`b`d`d`d`d`b`d`d`a`a`a`d`d`a`a`a`a`",
+"`a`a`a`b`b`b`b`b`b`b`b`b`b`b`b`d`b`d`a`d`d`a`d`d`d`d`a`d`a`a`a`a",
+"a`a`a`b`b`b`b`b`b`b`b`b`b`b`b`b`d`a`a`d`a`d`d`a`d`a`d`d`a`a`a`a`",
+"`a`a`a`b`b`b`b`b`b`b`b`b`b`b`b`d`a`d`a`d`d`a`d`a`a`d`a`d`d`a`a`a",
+"a`a`a`a`b`b`b`b`b`b`b`b`b`b`a`b`a`a`a`a`a`a`a`a`a`a`a`a`a`a`a`a`",
+"`a`a`a`a`a`b`b`b`b`b`b`b`b`a`a`a`a`a`a`a`a`a`a`a`a`a`a`a`a`a`a`a"
+};
Added
New image
+#define e_width 64
+#define e_height 42
+static unsigned char e_bits[] = {
+  0xc6, 0x01, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00,
+  0x00, 0x00, 0x00, 0x00, 0x08, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00,
+  0xbd, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x70, 0x25, 0x80, 0x47,
+  0x00, 0x00, 0x00, 0x00, 0xf3, 0xbe, 0xfd, 0xff, 0x0b, 0x00, 0x00, 0x00,
+  0xfe, 0xff, 0xff, 0xff, 0xff, 0x12, 0x40, 0x12, 0xff, 0xff, 0xff, 0xff,
+  0xbb, 0xd0, 0x9b, 0x4d, 0xfd, 0xff, 0xff, 0xff, 0x4f, 0x99, 0xb3, 0xc9,
+  0xff, 0xff, 0xff, 0xff, 0xff, 0x00, 0x87, 0x00, 0xff, 0xff, 0xff, 0xff,
+  0x2f, 0x00, 0x00, 0x00, 0xff, 0xff, 0xff, 0xff, 0x6d, 0x02, 0x00, 0x00,
+  0xff, 0xff, 0xff, 0xff, 0xbb, 0x08, 0x00, 0x80, 0xff, 0xff, 0xff, 0xff,
+  0xff, 0x0d, 0x00, 0x80, 0xdf, 0xff, 0xff, 0xff, 0xff, 0x3f, 0x03, 0x00,
+  0xc1, 0xff, 0xff, 0xff, 0xff, 0xff, 0x88, 0x40, 0x94, 0xff, 0xff, 0xff,
+  0xff, 0xff, 0xaf, 0x08, 0x50, 0xff, 0xff, 0xff, 0xff, 0xff, 0x1f, 0x00,
+  0xc0, 0xff, 0xff, 0xff, 0xf5, 0xff, 0x7f, 0x01, 0xd0, 0xff, 0xff, 0x97,
+  0xff, 0xff, 0xff, 0x00, 0xd0, 0xff, 0xff, 0x97, 0xff, 0xff, 0xff, 0x03,
+  0xe0, 0xff, 0xf2, 0xc3, 0xff, 0xff, 0xff, 0x05, 0xe0, 0x7f, 0xf1, 0xc3,
+  0xfd, 0xff, 0xff, 0x01, 0xe0, 0x3f, 0xf0, 0xc3, 0x7f, 0xfe, 0xdf, 0x00,
+  0xf0, 0x0f, 0xf0, 0xdf, 0x7f, 0xf8, 0x7f, 0x00, 0xf0, 0x1f, 0xe0, 0xff,
+  0x3f, 0xf0, 0x3f, 0x00, 0xa0, 0x00, 0xe0, 0xff, 0x3f, 0xf8, 0x3f, 0x00,
+  0xa0, 0x0c, 0xc0, 0xff, 0x1f, 0xf8, 0x01, 0x00, 0x00, 0x0e, 0x00, 0x38,
+  0x0c, 0x0c, 0x03, 0x00, 0x10, 0x0e, 0x00, 0x93, 0x01, 0x60, 0x00, 0x00,
+  0x00, 0x0e, 0x00, 0xcf, 0x01, 0x30, 0x00, 0x00, 0x00, 0x27, 0x00, 0x40,
+  0x00, 0x00, 0x00, 0x00, 0x00, 0x07, 0x00, 0x80, 0xc1, 0x36, 0xd8, 0x07,
+  0x80, 0x93, 0x00, 0x80, 0xe3, 0x76, 0xdc, 0x00, 0x00, 0x30, 0x1c, 0x80,
+  0xe3, 0x76, 0xdc, 0x00, 0x00, 0xf2, 0x9f, 0x80, 0xf7, 0xf6, 0xde, 0x07,
+  0x00, 0x00, 0x59, 0x90, 0xd5, 0xb6, 0xda, 0x00, 0x00, 0x80, 0x28, 0x90,
+  0xdd, 0xb6, 0xdb, 0x00, 0x00, 0x00, 0x00, 0x80, 0xc9, 0x36, 0xd9, 0x00,
+  0x00, 0x00, 0x00, 0x80, 0xc9, 0x36, 0xd9, 0x07, 0x00, 0x00, 0x00, 0x00,
+  0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00,
+  };
Added
New image
+#define ee_width 64
+#define ee_height 42
+static char ee_bits[] = {
+ 0xc6,0x01,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00,
+ 0x00,0x08,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00,
+ 0x00,0x00,0x70,0x25,0x80,0x47,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00,
+ 0x00,0x00,0x00,0xfe,0xff,0xff,0xff,0xff,0x12,0x40,0x12,0x00,0x00,0x00,0x00,
+ 0x00,0x00,0x00,0x00,0xfd,0xff,0xff,0xff,0x4f,0x99,0xb3,0xc9,0x00,0x00,0x00,
+ 0x00,0x00,0x00,0x00,0x00,0xff,0xff,0xff,0xff,0x2f,0x00,0x00,0x00,0x00,0x00,
+ 0x00,0x00,0x00,0x00,0x00,0x00,0xff,0xff,0xff,0xff,0xbb,0x08,0x00,0x80,0x00,
+ 0x00,0x00,0x00,0x00,0x00,0x00,0x00,0xdf,0xff,0xff,0xff,0xff,0x3f,0x03,0x00,
+ 0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x94,0xff,0xff,0xff,0xff,0xff,0xaf,
+ 0x08,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0xc0,0xff,0xff,0xff,0xf5,0xff,
+ 0x7f,0x01,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0xd0,0xff,0xff,0x97,0xff,
+ 0xff,0xff,0x03,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0xe0,0x7f,0xf1,0xc3,
+ 0xfd,0xff,0xff,0x01,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0xf0,0x0f,0xf0,
+ 0xdf,0x7f,0xf8,0x7f,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0xa0,0x00,
+ 0xe0,0xff,0x3f,0xf8,0x3f,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00,
+ 0x0e,0x00,0x38,0x0c,0x0c,0x03,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00,
+ 0x00,0x0e,0x00,0xcf,0x01,0x30,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00,
+ 0x00,0x00,0x07,0x00,0x80,0xc1,0x36,0xd8,0x07,0x00,0x00,0x00,0x00,0x00,0x00,
+ 0x00,0x00,0x00,0x30,0x1c,0x80,0xe3,0x76,0xdc,0x00,0x00,0x00,0x00,0x00,0x00,
+ 0x00,0x00,0x00,0x00,0x00,0x59,0x90,0xd5,0xb6,0xda,0x00,0x00,0x00,0x00,0x00,
+ 0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x80,0xc9,0x36,0xd9,0x00,0x00,0x00,0x00,
+ 0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00,0x00,
+ 0x00,0x00,0x00,0x00,0x00,0x00};

etc/w3/stylesheet

 ** Since Emacs-19 doesn't handle mixed-sized fonts very well just yet,
 ** we only use them under XEmacs.  Hopefully, this will change soon.
 */
-
 @media xemacs {
       h1  { font-size : +12pt }
       h2  { font-size : +6pt  }
 @media emacs {
 h1,h2,h3,
 h4,h5,h6  { 
-            font-style: small-caps;
             text-decoration: underline;
 	    color: blue;
           }
 blockquote{ display: block; margin-left: 5; margin-right: 5; }
 
 /*
+** How to draw form elements.
+** This is an extension in Emacs-W3 (and perhaps soon E-Scape)
+** Since there are so many different types of input fields, you should be
+** able to control formatting based on that.  Enter pseudo-classes.
+**
+** This functionality will be removed as soon as the W3C comes up with
+** the standard way to do this, perhaps in CSS level 2.
+*/
+input { text-decoration: underline; }
+input:submit { color: green;  text-decoration: none; }
+input:reset  { color: red;    text-decoration: none; }
+input:button { color: yellow; text-decoration: none; }
+input:image  { text-decoration: none; }
+
+/*
 ** List formatting instructions
 */
 
 ** Hypertext link coloring
 */
 
-a         { cursor: hand2  }
 a:link    { color: #FF0000 }
 a:visited { color: #B22222 }
 a:active  { color: #FF0000 }

lib-src/make-docfile.c

 static void read_lisp_symbol (FILE *, char *);
 static int scan_lisp_file (CONST char *filename, CONST char *mode);
 
+#define C_IDENTIFIER_CHAR_P(c) \
+ (('A' <= c && c <= 'Z') || \
+  ('a' <= c && c <= 'z') || \
+  ('0' <= c && c <= '9') || \
+  (c == '_'))
+
 /* Name this program was invoked with.  */
 char *progname;
 
       char c = *p;
       int ident_start = 0;
 
+      /* Add support for ANSI prototypes. Hop over
+	 "Lisp_Object" string (the only C type allowed in DEFUNs) */
+      static char lo[] = "Lisp_Object";
+      if ((C_IDENTIFIER_CHAR_P (c) != in_ident) && !in_ident &&
+	  (strncmp (p, lo, sizeof (lo) - 1) == 0) &&
+	  isspace(*(p + sizeof (lo) - 1)))
+	{
+	  p += (sizeof (lo) - 1);
+	  while (isspace (*p))
+	    p++;
+	  c = *p;
+	}
+      
       /* Notice when we start printing a new identifier.  */
-      if ((('A' <= c && c <= 'Z')
-	   || ('a' <= c && c <= 'z')
-	   || ('0' <= c && c <= '9')
-	   || c == '_')
-	  != in_ident)
+      if (C_IDENTIFIER_CHAR_P (c) != in_ident)
 	{
 	  if (!in_ident)
 	    {
 	      in_ident = 1;
 	      ident_start = 1;
-
 #if 0
 	      /* XEmacs - This goes along with the change above. */
 	      if (need_space)
 		putc (' ', out);
-#endif 
-
+#endif
 	      if (minargs == 0 && maxargs > 0)
 		fprintf (out, "&optional ");
 	      just_spaced = 1;
 	 `defalt'; unmangle that here.  */
       if (ident_start
 	  && strncmp (p, "defalt", 6) == 0
-	  && ! (('A' <= p[6] && p[6] <= 'Z')
-		|| ('a' <= p[6] && p[6] <= 'z')
-		|| ('0' <= p[6] && p[6] <= '9')
-		|| p[6] == '_'))
+	  && ! C_IDENTIFIER_CHAR_P (p[6]))
 	{
 	  fprintf (out, "DEFAULT");
 	  p += 5;
 	  if (c != 'F')
 	    continue;
 	  c = getc (infile);
-	  defunflag = c == 'U';
+	  defunflag = (c == 'U');
 	  defvarflag = 0;
+	  c = getc (infile);
 	}
       else continue;
 
       c = read_c_string (infile, -1, 0);
 
       if (defunflag)
-	commas = 5;
+	commas = 4;
       else if (defvarperbufferflag)
 	commas = 2;
       else if (defvarflag)
 		{
 		  do
 		    c = getc (infile);
-		  while (c == ' ' || c == '\n' || c == '\t');
+		  while (c == ' ' || c == '\n' || c == '\t')
+		    ;
 		  if (c < 0)
 		    goto eof;
 		  ungetc (c, infile);
 	  if (defunflag && maxargs != -1)
 	    {
 	      char argbuf[1024], *p = argbuf;
+#if 0 /* For old DEFUN's only */
 	      while (c != ')')
 		{
 		  if (c < 0)
 		    goto eof;
 		  c = getc (infile);
 		}
+#endif
 	      /* Skip into arguments.  */
 	      while (c != '(')
 		{
 	      /* Skip until the first newline; remember the two previous chars. */
 	      while (c != '\n' && c >= 0)
 		{
+		  /* ### Kludge -- Ignore any ESC x x ISO2022 sequences */
+		  if (c == 27)
+		    {
+		      getc (infile);
+		      getc (infile);
+		      goto nextchar;
+		    }
+		  
 		  c2 = c1;
 		  c1 = c;
+		nextchar:
 		  c = getc (infile);
 		}
 	  
 	    {
 	      /* If the next three characters aren't `dquote bslash newline'
 		 then we're not reading a docstring.  */
-	      if ((c = getc (infile)) != '"' ||
+	      if ((c = getc (infile)) != '"'  ||
 		  (c = getc (infile)) != '\\' ||
 		  (c = getc (infile)) != '\n')
 		{
 	    }
 	}
 
-#ifdef DEBUG
+#if 0 /* causes crash */
       else if (! strcmp (buffer, "if") ||
 	       ! strcmp (buffer, "byte-code"))
 	;

lisp/bytecomp/bytecomp.el

 
 ;;; Copyright (C) 1985-1987, 1991-1994 Free Software Foundation, Inc.
 
-;; Author: Jamie Zawinski <jwz@lucid.com>
+;; Author: Jamie Zawinski <jwz@netscape.com>
 ;;	Hallvard Furuseth <hbf@ulrik.uio.no>
 ;; Keywords: internal
 
 		(not (eq (car rest) 'new-scope)))
       (setq cell (car rest))
       (if (and (= 0 (logand byte-compile-referenced-bit (cdr cell)))
-	       ;; Don't warn about declared-but-unused arguments, for two
-	       ;; reasons: first, the arglist structure might be imposed by
-	       ;; external forces, and we don't have (declare (ignore x)) yet;
-	       ;; and second, inline expansion produces forms like
+	       ;; Don't warn about declared-but-unused arguments,
+	       ;; for two reasons: first, the arglist structure
+	       ;; might be imposed by external forces, and we don't
+	       ;; have (declare (ignore x)) yet; and second, inline
+	       ;; expansion produces forms like
 	       ;;   ((lambda (arg) (byte-code "..." [arg])) x)
-	       ;; which we can't (ok, well, don't) recognise as containing a
-	       ;; reference to arg, so every inline expansion would generate
-	       ;; a warning.  (If we had `ignore' then inline expansion could
-	       ;; emit an ignore declaration.)
+	       ;; which we can't (ok, well, don't) recognise as
+	       ;; containing a reference to arg, so every inline
+	       ;; expansion would generate a warning.  (If we had
+	       ;; `ignore' then inline expansion could emit an
+	       ;; ignore declaration.)
 	       (= 0 (logand byte-compile-arglist-bit (cdr cell)))
-	       ;; Don't warn about defvars because this is a legitimate special
-	       ;; binding.
+	       ;; Don't warn about defvars because this is a
+	       ;; legitimate special binding.
 	       (not (byte-compile-defvar-p (car cell))))
 	  (setq unreferenced (cons (car cell) unreferenced)))
       (setq rest (cdr rest)))

lisp/cl/cl-macs.el

   (cond ((eq (car-safe spec) 'special)
 	 (if (boundp 'byte-compile-bound-variables)
 	     (setq byte-compile-bound-variables
-		   (append (cdr spec) byte-compile-bound-variables))))
+		   ;; todo: this should compute correct binding bits vs. 0
+		   (append (mapcar #'(lambda (v) (cons v 0)) 
+				   (cdr spec))
+			   byte-compile-bound-variables))))
 
 	((eq (car-safe spec) 'inline)
 	 (while (setq spec (cdr spec))

lisp/custom/custom-edit.el

 ;;
 ;; Author: Per Abrahamsen <abraham@dina.kvl.dk>
 ;; Keywords: help, faces
-;; Version: 1.24
+;; Version: 1.30
 ;; X-URL: http://www.dina.kvl.dk/~abraham/custom/
 
 ;;; Commentary:

lisp/custom/custom.el

 ;;
 ;; Author: Per Abrahamsen <abraham@dina.kvl.dk>
 ;; Keywords: help, faces
-;; Version: 1.24
+;; Version: 1.30
 ;; X-URL: http://www.dina.kvl.dk/~abraham/custom/
 
 ;;; Commentary:
 (define-widget-keywords :prefix :tag :load :link :options :type :group)
 
 ;; These autoloads should be deleted when the file is added to Emacs
-(autoload 'customize "custom-edit" nil t)
-(autoload 'customize-variable "custom-edit" nil t)
-(autoload 'customize-face "custom-edit" nil t)
-(autoload 'customize-apropos "custom-edit" nil t)
-(autoload 'customize-customized "custom-edit" nil t)
-(autoload 'custom-buffer-create "custom-edit")
-(autoload 'custom-menu-update "custom-edit")
-(autoload 'custom-make-dependencies "custom-edit")
+(unless (fboundp 'load-gc)
+  (autoload 'customize "custom-edit" nil t)
+  (autoload 'customize-variable "custom-edit" nil t)
+  (autoload 'customize-face "custom-edit" nil t)
+  (autoload 'customize-apropos "custom-edit" nil t)
+  (autoload 'customize-customized "custom-edit" nil t)
+  (autoload 'custom-buffer-create "custom-edit")
+  (autoload 'custom-menu-update "custom-edit")
+  (autoload 'custom-make-dependencies "custom-edit"))
 
 ;;; Compatibility.
 
 
 ;;; The `defcustom' Macro.
 
-;;;###autoload
+;;; Don't ;;;###autoload
 (defun custom-declare-variable (symbol value doc &rest args)
   "Like `defcustom', but SYMBOL and VALUE are evaluated as notmal arguments."
   (unless (and (default-boundp symbol)
   (run-hooks 'custom-define-hook)
   symbol)
 
-;;;###autoload
+;;; Don't ;;;###autoload
 (defmacro defcustom (symbol value doc &rest args)
   "Declare SYMBOL as a customizable variable that defaults to VALUE.
 DOC is the variable documentation.
 
 ;;; The `defface' Macro.
 
-;;;###autoload
+;;; Don't ;;;###autoload
 (defun custom-declare-face (face spec doc &rest args)
   "Like `defface', but FACE is evaluated as a normal argument."
   (put face 'factory-face spec)
   (run-hooks 'custom-define-hook)
   face)
 
-;;;###autoload
+;;; Don't ;;;###autoload
 (defmacro defface (face spec doc &rest args)
   "Declare FACE as a customizable face that defaults to SPEC.
 FACE does not need to be quoted.
 
 ;;; The `defgroup' Macro.
 
-;;;###autoload
+;;; Don't ;;;###autoload
 (defun custom-declare-group (symbol members doc &rest args)
   "Like `defgroup', but SYMBOL is evaluated as a normal argument."
   (put symbol 'custom-group (nconc members (get symbol 'custom-group)))
   (run-hooks 'custom-define-hook)
   symbol)
 
-;;;###autoload
+;;; Don't ;;;###autoload
 (defmacro defgroup (symbol members doc &rest args)
   "Declare SYMBOL as a customization group containing MEMBERS.
 SYMBOL does not need to be quoted.
 information."
   `(custom-declare-group (quote ,symbol) ,members ,doc ,@args))
 
-;;;###autoload
+;;; Don't ;;;###autoload
 (defun custom-add-to-group (group option widget)
   "To existing GROUP add a new OPTION of type WIDGET,
 If there already is an entry for that option, overwrite it."
       match)))
 
 (defconst custom-face-attributes
-  '((:bold (toggle :format "Bold: %v") custom-set-face-bold)
-    (:italic (toggle :format "Italic: %v") custom-set-face-italic)
+  '((:bold (toggle :format "Bold: %[%v%]\n") custom-set-face-bold)
+    (:italic (toggle :format "Italic: %[%v%]\n") custom-set-face-italic)
     (:underline
-     (toggle :format "Underline: %v") set-face-underline-p)
+     (toggle :format "Underline: %[%v%]\n") set-face-underline-p)
     (:foreground (color :tag "Foreground") set-face-foreground)
     (:background (color :tag "Background") set-face-background)
     (:stipple (editable-field :format "Stipple: %v") set-face-stipple))
       (make-face-italic face frame)
     (make-face-unitalic face frame)))
 
-;;;###autoload
+;;; Don't ;;;###autoload
 (defun custom-initialize-faces (&optional frame)
   "Initialize all custom faces for FRAME.
 If FRAME is nil or omitted, initialize them for all frames."
 
 ;;; Initializing.
 
-;;;###autoload
+;;; Don't ;;;###autoload
 (defun custom-set-variables (&rest args)
   "Initialize variables according to user preferences.  
 
 	  (put symbol 'saved-value (list value)))
 	(setq args (cdr (cdr args)))))))
 
-;;;###autoload
+;;; Don't ;;;###autoload
 (defun custom-set-faces (&rest args)
   "Initialize faces according to user preferences.
 The arguments should be a list where each entry has the form:
 		 (easy-menu-create-keymaps (car custom-help-menu)
 					   (cdr custom-help-menu)))))))
 
-; (custom-menu-reset)
+(unless (fboundp 'load-gc)
+  (custom-menu-reset))
 
 ;;; The End.
 

lisp/custom/widget-edit.el

 ;;
 ;; Author: Per Abrahamsen <abraham@dina.kvl.dk>
 ;; Keywords: extensions
-;; Version: 1.24
+;; Version: 1.30
 ;; X-URL: http://www.dina.kvl.dk/~abraham/custom/
 
 ;;; Commentary:
 				      items nil t)
 		     items)))))
 
+(defun widget-get-sibling (widget)
+  "Get the item WIDGET is assumed to toggle.
+This is only meaningful for radio buttons or checkboxes in a list."
+  (let* ((parent (widget-get widget :parent))
+	 (children (widget-get parent :children))
+	 child)
+    (catch 'child
+      (while children
+	(setq child (car children)
+	      children (cdr children))
+	(when (eq (widget-get child :button) widget)
+	  (throw 'child child)))
+      nil)))
+
 ;;; Widget text specifications.
 ;; 
 ;; These functions are for specifying text properties. 
 
     (unless (widget-get widget :size)
       (add-text-properties to (1+ to) (list 'field widget
-					    'face face
-					    'local-map map
-					    'keymap map)))))
+					    'face face)))
+    (add-text-properties to (1+ to) (list 'local-map map
+					  'keymap map))))
 
 (defun widget-specify-button (widget from to)
   ;; Specify button for WIDGET between FROM and TO.
 
 ;;; Widget Properties.
 
+(defsubst widget-name (widget)
+  "Return the name of WIDGET, asymbol."
+  (car widget))
+
 (defun widget-put (widget property value)
   "In WIDGET set PROPERTY to VALUE.
 The value can later be retrived with `widget-get'."
 
 (unless widget-keymap 
   (setq widget-keymap (make-sparse-keymap))
+  (define-key widget-keymap "\C-k" 'widget-kill-line)
   (define-key widget-keymap "\t" 'widget-forward)
   (define-key widget-keymap "\M-\t" 'widget-backward)
   (define-key widget-keymap [(shift tab)] 'widget-backward)
 (unless widget-field-keymap 
   (setq widget-field-keymap (copy-keymap widget-keymap))
   (define-key widget-field-keymap "\C-m" 'widget-field-activate)
+  (define-key widget-field-keymap "\C-a" 'widget-beginning-of-line)
+  (define-key widget-field-keymap "\C-e" 'widget-end-of-line)
   (set-keymap-parent widget-field-keymap global-map))
 
 (defvar widget-text-keymap nil
 
 (unless widget-text-keymap 
   (setq widget-text-keymap (copy-keymap widget-keymap))
+  (define-key widget-text-keymap "\C-a" 'widget-beginning-of-line)
+  (define-key widget-text-keymap "\C-e" 'widget-end-of-line)
   (set-keymap-parent widget-text-keymap global-map))
 
 (defun widget-field-activate (pos &optional event)
   (run-hooks 'widget-backward-hook)
   (widget-move (- arg)))
 
+(defun widget-beginning-of-line ()
+  "Go to beginning of field or beginning of line, whichever is first."
+  (interactive)
+  (let ((bol (save-excursion (beginning-of-line) (point)))
+	(prev (previous-single-property-change (point) 'field)))
+    (goto-char (max bol (or prev bol)))))
+
+(defun widget-end-of-line ()
+  "Go to end of field or end of line, whichever is first."
+  (interactive)
+  (let ((bol (save-excursion (end-of-line) (point)))
+	(prev (next-single-property-change (point) 'field)))
+    (goto-char (min bol (or prev bol)))))
+
+(defun widget-kill-line ()
+  "Kill to end of field or end of line, whichever is first."
+  (interactive)
+  (let ((field (get-text-property (point) 'field))
+	(newline (save-excursion (search-forward "\n")))
+	(next (next-single-property-change (point) 'field)))
+    (if (and field (> newline next))
+	(kill-region (point) next)
+      (call-interactively 'kill-line))))
+
+(defun widget-identify (pos)
+  "Identify the widget under point."
+  (interactive "d")
+  (let* ((field (get-text-property pos 'field))
+	 (button (get-text-property pos 'button))
+	 (doc (get-text-property pos 'widget-doc))
+	 (widget (or field button doc)))
+    (with-output-to-temp-buffer "*Widget Identity*"
+      (princ (cond (field "This is an editable text area.\n")
+		   (button "This is an active area.\n")
+		   (doc "This is documentation text.\n")
+		   (t "This is unidentified text.\n")))
+      (while widget
+	(princ "It is part of a `")
+	(princ (car widget))
+	(princ "' widget (value: ")
+	(prin1 (condition-case nil
+		   (widget-value widget)
+		 (error 'error)))
+	(princ ").\n")
+	(when (eq (car widget) 'radio-button)
+	  (let ((sibling (widget-get-sibling widget)))
+	    (if (not sibling)
+		(princ "It doesn't seem to control anything.\n")
+	      (princ "The value of its sibling is: ")
+	      (prin1 (condition-case nil
+			 (widget-value sibling)
+		       (error 'error)))
+	      (princ ".\n"))))
+	(setq widget (widget-get widget :parent))))))
+
 ;;; Setting up the buffer.
 
 (defvar widget-field-new nil)
 
 ;;; The `toggle' Widget.
 
-(define-widget 'toggle 'menu-choice
+(define-widget 'toggle 'item
   "Toggle between two states."
-  :convert-widget 'widget-toggle-convert-widget
-  :format "%v"
+  :format "%[%v%]\n"
+  :value-create 'widget-toggle-value-create
+  :action 'widget-toggle-action
+  :match (lambda (widget value) t)
   :on "on"
   :off "off")
 
-(defun widget-toggle-convert-widget (widget)
-  ;; Create the types representing the `on' and `off' states.
-  (let ((on-type (widget-get widget :on-type))
-	(off-type (widget-get widget :off-type)))
-    (unless on-type
-      (setq on-type
-	    (list 'choice-item 
-		  :value t
-		  :match (lambda (widget value) value)
-		  :tag (widget-get widget :on))))
-    (unless off-type
-      (setq off-type
-	    (list 'choice-item :value nil :tag (widget-get widget :off))))
-    (widget-put widget :args (list on-type off-type)))
-  widget)
+(defun widget-toggle-value-create (widget)
+  ;; Insert text representing the `on' and `off' states.
+  (if (widget-value widget)
+      (insert (widget-get widget :on))
+    (insert (widget-get widget :off))))
 
+(defun widget-toggle-action (widget &optional event)
+  ;; Toggle value.
+  (widget-value-set widget (not (widget-value widget)))
+  (widget-apply widget :notify widget event))
+  
 ;;; The `checkbox' Widget.
 
 (define-widget 'checkbox 'toggle
   "A checkbox toggle."
-  :convert-widget 'widget-item-convert-widget
-  :on-type '(choice-item :format "%[[X]%]" t)
-  :off-type  '(choice-item :format "%[[ ]%]" nil))
+  :format "%[%v%]"
+  :on "[X]"
+  :off "[ ]")
 
 ;;; The `checklist' Widget.
 
 (define-widget 'radio-button 'toggle
   "A radio button for use in the `radio' widget."
   :notify 'widget-radio-button-notify
-  :on-type '(choice-item :format "%[(*)%]" t)
-  :off-type '(choice-item :format "%[( )%]" nil))
+  :format "%[%v%]"
+  :on "(*)"
+  :off "( )")
 
 (defun widget-radio-button-notify (widget child &optional event)
-  ;; Notify the parent.
+  ;; Tell daddy.
   (widget-apply (widget-get widget :parent) :action widget event))
 
 ;;; The `radio-button-choice' Widget.
 (define-widget 'boolean 'toggle
   "To be nil or non-nil, that is the question."
   :tag "Boolean"
-  :format "%{%t%}: %v")
+  :format "%{%t%}: %[%v%]")
 
 ;;; The `color' Widget.
 

lisp/custom/widget-example.el

 ;;
 ;; Author: Per Abrahamsen <abraham@dina.kvl.dk>
 ;; Keywords: help, extensions, faces, hypermedia
-;; Version: 1.24
+;; Version: 1.30
 ;; X-URL: http://www.dina.kvl.dk/~abraham/custom/
 
 (require 'widget)

lisp/custom/widget.el

 ;;
 ;; Author: Per Abrahamsen <abraham@dina.kvl.dk>
 ;; Keywords: help, extensions, faces, hypermedia
-;; Version: 1.24
+;; Version: 1.30
 ;; X-URL: http://www.dina.kvl.dk/~abraham/custom/
 
 ;;; Commentary:

lisp/gnus/custom-opt.el

+;;; custom-opt.el --- An option group.
+;;
+;; Copyright (C) 1996 Free Software Foundation, Inc.
+;;
+;; Author: Per Abrahamsen <abraham@dina.kvl.dk>
+;; Keywords: help, faces
+;; Version: 1.24
+;; X-URL: http://www.dina.kvl.dk/~abraham/custom/
+
+;;; Code:
+
+(require 'custom)
+
+(defgroup options nil
+  "This group contains often used customization options."
+  :group 'emacs)
+
+(defvar custom-options 
+  '((line-number-mode boolean)
+    (column-number-mode boolean)
+    (debug-on-error boolean)
+    (debug-on-quit boolean)
+    (case-fold-search boolean)
+    (case-replace boolean)
+    (transient-mark-mode boolean))
+  "Alist of customization options.
+The first element of each entry should be a variable name, the second
+a widget type.")
+
+(let ((options custom-options)
+      option name type)
+  (while options
+    (setq option (car options)
+	  options (cdr options)
+	  name (nth 0 option)
+	  type (nth 1 option))
+    (put name 'custom-type type)
+    (custom-add-to-group 'options name 'custom-variable))
+  (run-hooks 'custom-define-hook))
+
+;;; The End.
+
+(provide 'custom-opt)
+
+;; custom-edit.el ends here

lisp/iso/iso-acc.el

 ;; Copyright (C) 1993, 1994, 1996 Free Software Foundation, Inc.
 
 ;; Author: Johan Vromans <jv@mh.nl>
-;; Version: 1.8
-;; Maintainer: FSF
+;; Maintainer: Alexandre Oliva <oliva@dcc.unicamp.br>
 ;; Keywords: i18n
 ;; Adapted to XEmacs 19.14 by Alexandre Oliva <oliva@dcc.unicamp.br>
-;; Last update: Jan 25, 1997
+;; $Revision: 1.3 $
+;; $Date: 1997/02/09 23:51:31 $
 
 ;; This file is part of GNU Emacs.
 
 ;;   "  (second)    -> diaeresis
 ;;   ^  (caret)     -> circumflex
 ;;   ~  (tilde)     -> tilde over the character
-;;   /  (slash)     -> slash through the character.
-;;   ,  (cedilla)   -> cedilla under the character (except on default mode).
-;;		  Also:  /A is A-with-ring and /E is AE ligature.
+;;   /  (slash)     -> slash through the character
+;;   .  (dot)       -> dot over the character
+;;   ,  (cedilla)   -> cedilla under the character (except on default mode)
+;;                  Also:  /A is A-with-ring and /E is AE ligature.
 ;;
 ;; The action taken depends on the key that follows the pseudo accent.
 ;; In general: 
 ;;
 ;;   pseudo-accent + appropriate letter -> accented letter
-;;   pseudo-accent + space -> pseudo-accent (except for comma)
+;;   pseudo-accent + space -> pseudo-accent (except comma)
 ;;   pseudo-accent + pseudo-accent -> accent (if available)
 ;;   pseudo-accent + other -> pseudo-accent + other
 ;;
 (if (fboundp 'read-event) ()
   (defun read-event () (event-key (next-command-event))))
 
-;; needed to work on GNU Emacs (had to use this function on XEmacs)
-(if (fboundp 'character-to-event) ()
-  (defun character-to-event (ch &optional event console meta)
-    (if (listp ch) (car ch) ch)))
+(if (fboundp 'character-to-event)
+    (defun iso-char-to-event (ch)
+      "returns an event containing the given character"
+      (character-to-event (list ch)))
+  (defun iso-char-to-event (ch)
+    "returns the character itself"
+    ch))
 
 ;; needed for compatibility with XEmacs 19.14 and GNU Emacs 19.30
 (if (fboundp 'this-single-command-keys) ()
 	(this-command-keys))
     (defun this-single-command-keys () (this-command-keys))))
 
+;; end of compatibility modules
+
 (defvar iso-languages
   '(("portuguese"
      (?' (?A . ?\301) (?E . ?\311) (?I . ?\315) (?O . ?\323) (?U . ?\332)
      (?^ (?A . ?\302) (?E . ?\312) (?O . ?\324) (?a . ?\342) (?e . ?\352)
 	 (?o . ?\364) (?\  . ?^) (space . ?^))
      (?\" (?U . ?\334) (?u . ?\374) (?\  . ?\") (space . ?\"))
-     (?\~ (?A . ?\303) (?O . ?\325) (?a . ?\343) (?o . ?\365) (?\  . ?\~) (space . ?\~))
+     (?\~ (?A . ?\303) (?O . ?\325) (?a . ?\343) (?o . ?\365) (?\  . ?\~)
+	  (space . ?\~))
      (?, (?c . ?\347) (?C . ?\307)))
     
     ("irish"
 	 (?\  . ?') (space . ?')))
     
     ("french"
-     (?' (?A . ?\301) (?E . ?\311) (?I . ?\315) (?O . ?\323) (?U . ?\332)
-	 (?C . ?\307) (?a . ?\341) (?e . ?\351) (?i . ?\355) (?o . ?\363)
-	 (?u . ?\372) (?c . ?\347) (?\  . ?') (space . ?'))
-     (?` (?A . ?\300) (?E . ?\310) (?a . ?\340) (?e . ?\350) (?\  . ?`) (space . ?`))
+     (?' (?E . ?\311) (?C . ?\307) (?e . ?\351) (?c . ?\347) (?\  . ?')
+	 (space . ?'))
+     (?` (?A . ?\300) (?E . ?\310) (?a . ?\340) (?e . ?\350) (?\  . ?`)
+	 (space . ?`))
      (?^ (?A . ?\302) (?E . ?\312) (?I . ?\316) (?O . ?\324) (?U . ?\333)
 	 (?a . ?\342) (?e . ?\352) (?i . ?\356) (?o . ?\364) (?u . ?\373)
 	 (?\  . ?^) (space . ?^))
-     (?\" (?U . ?\334) (?u . ?\374) (?\  . ?\") (space . ?\"))
-     (?\~ (?A . ?\303) (?O . ?\325) (?a . ?\343) (?o . ?\365) (?\  . ?\~) (space . ?\~))
+     (?\" (?E . ?\313) (?I . ?\317)  
+          (?e . ?\353) (?i . ?\357) (?\  . ?\") (space . ?\"))
+     (?\~ (?< . ?\253) (?> . ?\273) (?C . ?\307) (?c . ?\347) (?\  . ?\~)
+	  (space . ?\~))
      (?, (?c . ?\347) (?C . ?\307)))
     
+   ;;; ISO-8859-3, developed by D. Dale Gulledge <ddg@cci.com>
+    ("latin-3"
+     (?' (?A . ?\301) (?E . ?\311) (?I . ?\315) (?O . ?\323)
+	 (?U . ?\332) (?a . ?\341) (?e . ?\351) (?i . ?\355)
+     	 (?o . ?\363) (?u . ?\372) (?\  . ?') (space . ?'))
+     (?. (?C . ?\305) (?G . ?\325) (?I . ?\251) (?Z . ?\257)
+	 (?c . ?\345) (?g . ?\365) (?z . ?\277))
+     (?\" (?A . ?\304) (?E . ?\313) (?I . ?\317) (?O . ?\326)
+	  (?U . ?\334) (?a . ?\344) (?e . ?\353) (?i . ?\357)
+	  (?o ?\366) (?u ?\374) (?\  . ?\") (space . ?\"))
+     (?\/ (?\/ . ?\260) (?\  . ?/) (space . ?/))
+     (?\~ (?C . ?\307) (?G . ?\253) (?N . ?\321) (?S . ?\252)
+          (?U . ?\335) (?\~ . ?\270) (?c . ?\347) (?g . ?\273)
+	  (?h . ?\261) (?n . ?\361) (?u . ?\375)
+	  (?\  . ?~) (space . ?~))
+     (?^ (?A . ?\302) (?C . ?\306) (?E . ?\312) (?G . ?\330)
+	 (?H . ?\246) (?I . ?\316) (?J . ?\254) (?O . ?\324)
+	 (?S . ?\336) (?U . ?\333) (?a . ?\342) (?c . ?\346)
+	 (?e . ?\352) (?g . ?\370) (?h . ?\266) (?i . ?\356)
+	 (?j . ?\274) (?o . ?\364) (?s . ?\376) (?u . ?\373)
+	 (?\  . ?^) (space . \^))
+     (?` (?A . ?\300) (?E . ?\310) (?I . ?\314) (?O . ?\322)
+	 (?U . ?\331) (?a . ?\340) (?e . ?\350) (?i . ?\354)
+	 (?o . ?\362) (?u . ?\371) (?\  . ?`) (space . ?`)))
+
     ("latin-2"
      (?' (?A . ?\301) (?C . ?\306) (?D . ?\320) (?E . ?\311) (?I . ?\315)
 	 (?L . ?\305) (?N . ?\321) (?O . ?\323) (?R . ?\300) (?S . ?\246)
 See the function `iso-accents-mode'.")
 (make-variable-buffer-local 'iso-accents-mode)
 
-(defvar iso-accents-enable '(?' ?` ?^ ?\" ?~ ?/ ?,)
+(defvar iso-accents-enable '(?' ?` ?^ ?\" ?~ ?/ ?, ?.)
   "*List of accent keys that become prefixes in ISO Accents mode.
-The default is (?' ?` ?^ ?\" ?~ ?/ ?,), which contains all the supported
+The default is (?' ?` ?^ ?\" ?~ ?/ ?, ?.), which contains all the supported
 accent keys.  If you set this variable to a list in which some of those
 characters are missing, the missing ones do not act as accents.
 
 			  (delete-region (1- (point)) (point)))))
 	 (entry (cdr (assq second-char list))))
     (if entry
-	;; Found it: insert the accented character and
-	;; return a do-nothing key
-        (vector (character-to-event (list entry)))
+	;; Found it: return the mapped char
+        (vector (iso-char-to-event entry))
       ;; Otherwise, advance and schedule the second key for execution.
-      (setq unread-command-events (append
-				   (list
-				    (character-to-event (list second-char)))
-				   unread-command-events))
-      (vector (character-to-event (list first-char))))))
+      (setq unread-command-events (cons (iso-char-to-event second-char)
+					unread-command-events))
+      (vector (iso-char-to-event first-char)))))
 
 ;; It is a matter of taste if you want the minor mode indicated
 ;; in the mode line...
     ;; Enable electric accents.
     (setq iso-accents-mode t)))
 
-(defvar iso-accents-mode-map nil)
-
 (defun iso-accents-customize (language)
   "Customize the ISO accents machinery for a particular language.
 It selects the customization based on the specifications in the
 `iso-languages' variable."
   (interactive (list (completing-read "Language: " iso-languages nil t)))
-  (let ((table (assoc language iso-languages)) tail acc)
+  (let ((table (assoc language iso-languages))
+	tail)
     (if (not table)
 	(error "Unknown language '%s'" language)
       (setq iso-language language
 	  (substitute-key-definition
 	   'iso-accents-accent-key nil key-translation-map)
 	(setq key-translation-map (make-sparse-keymap)))
-      (setq iso-accents-mode-map (make-sparse-keymap))
-      (let ((pair (assoc 'iso-accents-mode minor-mode-map-alist)))
-	(if pair
-	    (setcdr pair iso-accents-mode-map)
-	  (let ((l minor-mode-map-alist))
-	    (while (cdr l)
-	      (setq l (cdr l)))
-	    (setcdr l (list (cons 'iso-accents-mode iso-accents-mode-map))))))
       ;; Set up translations for all the characters that are used as
       ;; accent prefixes in this language.
       (setq tail iso-accents-list)
       (while tail
-	(define-key key-translation-map
-	  (vector (character-to-event (list (car (car tail)))))
+	(define-key key-translation-map (vector (iso-char-to-event
+						 (car (car tail))))
 	  'iso-accents-accent-key)
-	(setq acc (cdr (car tail)))
-	(while acc
-	  (define-key iso-accents-mode-map
-	    (vector (character-to-event (list (cdr (car acc)))))
-	    'iso-accents-self-insert-unless-redefined)
-	  (setq acc (cdr acc)))
 	(setq tail (cdr tail))))))
 
-(defun iso-accents-self-insert-unless-redefined (prompt)
-  "Temporarily disables iso-accents-mode, and checks for additional bindings of the keys that produced its invocation.  If no such binding is found, 'self-insert-command is returned"
-  (interactive "p")
-  (let* ((iso-accents-mode nil)
-	 (bind (key-binding (this-command-keys)))
-	 (repeat t) result)
-    (while repeat
-      (setq result
-	    (cond ((or (null bind)
-		       (eq bind 'self-insert-command))
-		   (setq repeat nil)
-		   (self-insert-command prompt))
-		  ((commandp bind)
-		   (setq repeat nil)
-		   (call-interactively bind))
-		  ((or (stringp bind)
-		       (keymapp bind))
-		   (setq repeat nil)
-		   bind)
-		  ((and (consp bind)
-			(stringp (car bind)))
-		   (setq bind (cdr bind)))
-		  ((and (consp bind)
-			(keymapp (car bind)))
-		   (setq bind (lookup-key (car bind) (cdr bind))))
-		  (t (error "Invalid key binding")))))
-    result))
-
 (defun iso-accentuate (start end)