cutadapt

[Former user]

Hello Eduardo,

I download miARma from the source on my mac and I successfully obtained the results after fetching the example data set from my pc. However, when I am trying to run the analysis of my desired dataset, I am getting the following error: -

[Thu Nov 1 21:37:03 2018] Starting a Adapter removal analysis CUTADAPT ERROR :: system args failed: 256 (mkdir -p Examples/basic_examples/miRNAs/Known_miRNAs/results/2.4///cutadapt_results/ ; cut_adapt -b AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCTACATCTCGTATGCCG -m 18 -M 26 -q 25 Examples/basic_examples/miRNAs/reads///231.fastq.gz > Examples/basic_examples/miRNAs/Known_miRNAs/results/2.4///cutadapt_results/231_cut.fastq 2>> Examples/basic_examples/miRNAs/Known_miRNAs/results/2.4//miARma_stat.6143.log) at lib/CbBio/RNASeq/Adapt.pm line 854.

I want to run the adapter removal for unknown adapter sequence, for which I am using the following setting in the config file:

[Adapter] ; ;#Specific software to remove the adapter from the sequences adaptersoft=CutAdapt ; ; #Minimun length of the sequence read to keep with Cutadapt and Reaper Software min=18 ; ; #Maximun length of the sequence read to use with Cutadapt Software max=26 ; ; #Minimun quality of the sequence read to use with Cutadapt Software min_quality=25 ; #Number of adapter predictions to show adaptpredictionnumber=12

Could you please help me in resolving this issue.

Thanks, Regards, Vasu Saini

[Eduardo Andres Leon]

Hi, Is the sequence "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCTACATCTCGTATGCCG" provided by you ? or is inferred by the miARma pipeline ?

If you are able to use the real adapter, the results will be improved. This adapter sequences is provided by your genomic facility

[Vasu Saini]

I am using a publicly available dataset to do some analysis. So I am not sure what the real adapter sequence is, that's why I used the minion to predict the sequence. I think this is predicted by the miARma pipeline.

[Vasu Saini]

i checked few other issues regarding cutadapt stated in the past, few of the users had the same error which was resolved by changing the python to an older version. however, even after trying different versions of python, I am still getting the same error. Currently, I am running python 2.7.12

[Vasu Saini]

Please find the attached logfiles.

[Eduardo Andres Leon]

First of all, I highly recommend you to rename the miARma folder: /Users/kayla/NGS/cbbio-miarma-54d2dc0fdd81 to /Users/kayla/NGS/cbbio-miarma (for example)

And finally, if you read the stat log file it says that 231.fastq.gz IOError: Not a gzipped file

[Vasu Saini]

Okay, My files are fastaq file, but the files for example set were in fastaq.gz file. Is it required to have it in the same format ? or normal fastaq files are good to go ?

And I have one more query, Can I install the software on windows like the way it can be downloaded on mac using source option?

[Eduardo Andres Leon]

you can use fastq or fastq.gz. But fastq.gz are recommend as they are smaller. But you can't have a fastq ended in gz if it not compressed.

About windows .... 99% of the tools included in miARma have not a windows binary, so only Unix systems are accepted

[Vasu Saini]

Hey Eduardo, Thanks for the response. Sorry for the delay in updating the results,

I am getting the following error in predicting adapter sequence:

Wed Nov 7 15:35:29 2018] Starting a Adapter removal analysis MINION ERROR :: system args failed: 7936 (minion search-adapter -i Examples/basic_examples/miRNAs/reads//sra1.fastq -show 4 1>/tmp/minion.sq 2>> Examples/basic_examples/miRNAs/Known_miRNAs/results2//miARma_stat.6034.log) Are you sure this fastq file contains and adapter sequence? at lib/CbBio/RNASeq/Adapt.pm line 1539.

[Eduardo Andres Leon]

Could you type "head sra1.fastq" ?

[Vasu Saini]

@SRR3713944.1.1 1 length=51 GCGACTGTTTAGCAAAAACAAGATCGGTAGAGCACCCGTCTTAACTTCTTT +SRR3713944.1.1 1 length=51 1>AAAD?DFFFFGDGFB1A1000A1000001111A000A/A/22AA2221D @SRR3713944.2.1 2 length=51 CAGCTTACTGGTACTAATAGGTCGAGATCGGAAGAGCACACGTCTGAACTC +SRR3713944.2.1 2 length=51 BBABBFFFFFFFGGGGGG554FF?224BA4222222A3B2A2B2B2553D5 @SRR3713944.3.1 3 length=51 GTACTAATAGGTCGAGGACTTAACCAGATCGGAAGAGCACACGTCTGAACT

I got this as the output

[Eduardo Andres Leon]

Did you known if these SRA file were already trimmed ? it looks like

[Vasu Saini]

I obtained this dataset from GEO. Moreover, I have two files and I am getting two different errors if I run them individually One file is giving me this error which I mentioned now.

And the second file is giving me a different error which I mentioned earlier in this post

[Eduardo Andres Leon]

earlier ? which one ?

[Vasu Saini]

Is there any way to detect whether the reads contain the adapter sequence or not ?

because I think the reads are of 51 bp in length. So, I highly doubt that they are devoid of adapter sequence.

[Eduardo Andres Leon]

This is an information that we expect to be known by the user If you don't know the adaptor, miARma predicts it and remove it if you know the adapter, miARma removes

But whether you know the adapter or not, you should know if this adapter is included or not. For example you can check the fastqc folder. It should contain html files where apart from the quality, you can check if an adapter sequence is appearing in your reads

[Vasu Saini]

HEY Eduardo,

sorry to disturb you again. I checked the log files and I could find a repetitive adapter sequence in that. I tried to run the program with that sequence.

But I am getting this error.

[Thu Nov 8 14:10:00 2018] Starting a Adapter removal analysis CUTADAPT ERROR :: system args failed: 256 (mkdir -p Examples/basic_examples/miRNAs/Known_miRNAs/results3///cutadapt_results/ ; cut_adapt -b GTAGCTCAGATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCT -m 18 -M 26 -q 25 Examples/basic_examples/miRNAs/reads///sra1.fastq > Examples/basic_examples/miRNAs/Known_miRNAs/results3///cutadapt_results/sra1_cut.fastq 2>> Examples/basic_examples/miRNAs/Known_miRNAs/results3//miARma_stat.6034.log) at lib/CbBio/RNASeq/Adapt.pm line 854.

Could you please help me with this ?

[Eduardo Andres Leon]

I think this is not an adapter it tends to be smaller.

Your error : Your sequences is 51 size and you are removing an adapter of 46 nt length, so there is no any sequence larger than 18 and smaller that 26 (-m 18 -M 26 )

[Vasu Saini]

This sequence is appearing in both the html files, and it shows similar corresponding illumina universal adapter sequence name. There is no other overexpressed sequence with a illumina adapter sequence name mentioned in either of those files.

[Vasu Saini]

Not to mention. None of the reads are in 100% of the sequence. Even most overexpressed read is in just 2% of the total read. Does it mean that the adapter sequence is already trimmed ?

[Eduardo Andres Leon]

I do think so

[Eduardo Andres Leon]

May I close the issue ?