The provided organism is not compatible with our software (human,rat,mouse)

[José Luis Ruiz]

Hi, Thanks for the software. I have tried to runf the miRNA and circRNA pipelines to the particular organism I'm working on. Everything is fine, up to a point where I get the error message:

MINION :: The provided organism is not compatible with our software (human,rat,mouse). Please write an email to [e-mail] to include it

mRNA pipelines are working fine Is there any way to include in the analysis organisms different from human rat or mouse?

Regards and thanks for your feedback

[Eduardo Andres Leon]

Hi, Minion is used when you don't known the adapter sequence used for the sequencing process. Are your files from EGA/SRA ? or are they sequenced by a genomic service ? In the latter case, you can ask for this sequence.

if not, let me know and I'll try to add your organism

[José Luis Ruiz]

The files are indeed from a genomic service. so I can try to get the sequence. How could I provide it to miARma? Specify it in the ini file the adapter cut step?

Thanks for your time

[Eduardo Andres Leon]

Yes you can ask the service for that sequence and then as in the example:

[Adapter]
; Adapter sequence to be removed in the analysis
adapter=ATCTCGTATGCCGTCTTCTGCTTGAA
; Specific software to remove the adapter from the sequences
adaptersoft=CutAdapt

[José Luis Ruiz]

Hi, I can confirm this is no longer and issue when I include the adapter sequence in cutadapt or I don't include the step in the pipeline.

Thanks for your help

[Eduardo Andres Leon]

Ok so I close it