Erros trying to execute miRNA de novo and circRNA examples

[José Luis Ruiz]

Hi So I have been trying to execute the examples of the different modes to make sure I haeve everything correctly installed and working. I have been able to run mRNA and miRNA pipelines, but miRNA de novo and circRNA keep failing. I leave below the errors for each pipeline. This is Ubuntu 16.04 and miARma 1.7.5

Thank you very much for your help

miRNA de novo:

The terminal is showing in the DeNovo part:

Starting a De novo identification and quantification of miRNAs
miRDeep ERROR :: system args failed: 512 (mkdir -p Examples/basic_examples/miRNAs/DeNovo_miRNAs/results//miRDeep_results/ ;export PERL5LIB=./lib/Perl/; mapper.pl Examples/basic_examples/miRNAs/reads//SRR873388.fastq -e -h -i -j -n -m -k ATCTCGTATGCCGTCTTCTGCTTGAA -o 4 -p Genomes/Indexes/bowtie1/human/bw1_homo_sapiens19 -s Examples/basic_examples/miRNAs/DeNovo_miRNAs/results//miRDeep_results/SRR873388.fa -t Examples/basic_examples/miRNAs/DeNovo_miRNAs/results//miRDeep_results/SRR873388_vs_genome.arf >> Examples/basic_examples/miRNAs/DeNovo_miRNAs/results//miARma_stat.29806.log 2>&1) at lib/CbBio/RNASeq/Aligner.pm line 2326.

I attach the logs (29806). I can see errors stating "SRR873383_vs_genome.arf is not in arf format" and regarding mirdeep2

miRDeep :: File:Examples/basic_examples/miRNAs/reads//SRR873389.fastq
Please run the install.pl script first before using the miRDeep2 package
The install script is located in /home/i7_station/bin/mirdeep2_pa so just do

cd /home/i7_station/bin/mirdeep2_pa
perl install.pl

I think something is wrong with the mirdeep2 version I have installed. But I I have no experience with mirdeep2 so I'm not sure what the errors mean.

circRNA:

The terminal is showing in the differential expression section:

Starting a differential expression analysis using Noiseq-EdgeR software(s)
Problem while running this R command:
print(resultsfiles)

Error:
print(resultsfiles) : object 'resultsfiles' not found
Execution halted

I attach the logs (29326). I'm not sure where are the errors and whether this is a duplicate of issue issue 129. If it is I can try some of the suggestions there. Thanks

[José Luis Ruiz]

Sorry, the logs can be found here in case they are of interest:

[Eduardo Andres Leon]

Hi Jose Luis,

miARma has miRDeep software included to make sure there is no problem regarding different versions. And the problem you are commenting seems to be related with your miRDeep version as the log says:

*Please run the install.pl script first before using the miRDeep2 package The install script is located in /home/i7_station/bin/mirdeep2_pa so just do

cd /home/i7_station/bin/mirdeep2_pa perl install.pl*

Regarding the circRNA, first of all, please rename the folder name to something easier: mv /home/i7_station/bin/miARma/cbbio-miarma-54d2dc0fdd81/ /home/i7_station/bin/miARma/miARma1.7.5

Then:

cd  /home/i7_station/bin/miARma/miARma1.7.5
R
source("./lib/CbBio/RNASeq/R-Scripts/DE_EdgeR.R")
setwd("/home/i7_station/bin/miARma//miARma1.7.5/Examples/basic_examples/circRNAs/results/circRNAs_results")
DE_EdgeR(projectdir="/home/i7_station/bin/miARma/miARma1.7.5/Examples/basic_examples/circRNAs/results/EdgeR_results",dir="/home/i7_station/bin/miARma/miARma1.7.5/Examples/basic_examples/circRNAs/results/circRNAs_results", file="/home/i7_station/bin/miARma/miARma1.7.5/Examples/basic_examples/circRNAs/results/circRNAs_results/circRNAs.tab", targetfile="/home/i7_station/bin/miARma/miARma1.7.5/Examples/basic_examples/circRNAs/data/targets.txt", label="Asthma_circRNAs.tab", contrastfile="/home/i7_station/bin/miARma/miARma1.7.5/Examples/basic_examples/circRNAs/data/contrast.txt", filter="no", replicates="yes", rpkm="no", file_size="/home/i7_station/bin/miARma/miARma1.7.5/Examples/basic_examples/circRNAs/results/circRNAs_results/circRNAs.tab", cpm="no")

please let me know what error appears on your screen

Thanks and regards

[José Luis Ruiz]

Regarding miRNA de novo pipeline I think I messed up with my miRDeep installation, because the folder the log said, "mirdeep2_pa", didn't even exist. I removed my miRDeep2 installation and now I'm getting an error on the differntial expression analysis section, the same one than in circRNA:

Starting a differential expression analysis using EdgeR-Noiseq software(s)
Problem while running this R command:
print(resultsfiles)

Error:
print(resultsfiles) : object 'resultsfiles' not found
Execution halted

Logs can be found here

Regarding circRNAs, the error in my screen is:

Loading required package: edgeR
Loading required package: limma
2019-01-23 21:47:34 Starting Differential expression analysis with EdgeR of Asthma_circRNAs.tab
Error in DE_EdgeR(projectdir = "/home/i7_station/bin/miARma/miARma1.7.5/Examples/basic_examples/circRNAs/results/EdgeR_results",  : 
  object 'y_rpkm' not found
In addition: Warning messages:
1: In max(abs(logR)) : no non-missing arguments to max; returning -Inf
2: In max(abs(logR)) : no non-missing arguments to max; returning -Inf
3: In max(abs(logR)) : no non-missing arguments to max; returning -Inf
4: In max(abs(logR)) : no non-missing arguments to max; returning -Inf
5: In max(abs(logR)) : no non-missing arguments to max; returning -Inf

Please let me know your suggestions. Thanks

[Eduardo Andres Leon]

Hi, I'm still trying to figure out what is happening

[José Luis Ruiz]

No problem, thank you for your time!