error while runing miARma

[Manoharan]

Hi,

I am getting following error.

Type of arg 1 to keys must be hash (not private variable) at lib//CbBio/RNASeq/DEAnalysis.pm line 1089, near "$comparisons)" Type of arg 1 to keys must be hash (not private variable) at lib//CbBio/RNASeq/DEAnalysis.pm line 1120, near "$comparisons)" Type of arg 1 to keys must be hash (not private variable) at lib//CbBio/RNASeq/DEAnalysis.pm line 1160, near "$summary_edger)" Type of arg 1 to keys must be hash (not private variable) at lib//CbBio/RNASeq/DEAnalysis.pm line 1173, near "$summary_noi)" BEGIN not safe after errors--compilation aborted at lib//CbBio/RNASeq/DEAnalysis.pm line 1184. Compilation failed in require at lib//CbBio/RNASeq/miARma.pm line 938. BEGIN failed--compilation aborted at lib//CbBio/RNASeq/miARma.pm line 938. Compilation failed in require at ./miARma line 82. BEGIN failed--compilation aborted at ./miARma line 82.

Thanks, Manoharan

[Eduardo Andres Leon]

Dear Manoharan, First of all I'd like to thank you for using miARma.

I've seen this error in an old issue by another user. Would you mind to tell me which OS are your using (and which version). And more important, miARma needs at least perl 5.16.x. Which perl version are you using ?

Kind regards

Edu

[Manoharan]

Dear Eduardo,

Thank you for your reply thank you user friendly tool,

I using OS : Red Hat Enterprise Linux Server release 6.5. perl my perl version is v5.10.1. I will try to update the perl.

Best Regards, Manoharan

[Manoharan]

Dear Eduardo,

I have update the perl still same issue continues. Could you please help me with this?

Thanks, Manoharan

[Eduardo Andres Leon]

Of course!

please tell me which perl version are you using and what type of error are you obtaining . Regards

[Manoharan]

DEar Eduardo,

I am getting same error. After I upgrading perl 5.24.0.

./miARma Examples/basic_examples/miRNAs/Known_miRNAs/Known_miRNAs_pipeline.ini Type of arg 1 to keys must be hash (not private variable) at lib//CbBio/RNASeq/DEAnalysis.pm line 1089, near "$comparisons)" Type of arg 1 to keys must be hash (not private variable) at lib//CbBio/RNASeq/DEAnalysis.pm line 1120, near "$comparisons)" Type of arg 1 to keys must be hash (not private variable) at lib//CbBio/RNASeq/DEAnalysis.pm line 1160, near "$summary_edger)" Type of arg 1 to keys must be hash (not private variable) at lib//CbBio/RNASeq/DEAnalysis.pm line 1173, near "$summary_noi)" BEGIN not safe after errors--compilation aborted at lib//CbBio/RNASeq/DEAnalysis.pm line 1184. Compilation failed in require at lib//CbBio/RNASeq/miARma.pm line 938. BEGIN failed--compilation aborted at lib//CbBio/RNASeq/miARma.pm line 938. Compilation failed in require at ./miARma line 82. BEGIN failed--compilation aborted at ./miARma line 82.

Regards, manoharan

[Eduardo Andres Leon]

Could you try to execute from the terminal:

$> perl5.24.0 miARma Examples/basic_examples/miRNAs/Known_miRNAs/Known_miRNAs_pipeline.ini

if you use ./miARma, I’m not really sure if the new perl is been using

You can additionally use:

perl5.24.0 -I miARma miARma Examples/basic_examples/miRNAs/Known_miRNAs/Known_miRNAs_pipeline.ini

Regards

[Manoharan]

Dear Eduardo,

I am getting following error.

/apps/perl-5.24.0/perl miARma Examples/basic_examples/miRNAs/Known_miRNAs/Known_miRNAs_pipeline.ini Experimental keys on scalar is now forbidden at lib/CbBio/RNASeq/DEAnalysis.pm line 1089. Compilation failed in require at lib/CbBio/RNASeq/miARma.pm line 938. BEGIN failed--compilation aborted at lib/CbBio/RNASeq/miARma.pm line 938. Compilation failed in require at miARma line 82. BEGIN failed--compilation aborted at miARma line 82.

Regards, manoharan

[Eduardo Andres Leon]

Dear Manoharan, Sorry for the delay but it was a nightmare to install perl 5.24 in my systems. I just want to tell you that I found the error (it's not really an error, from the version 5.23.8, perl changed the way to treat hashes) and I'm changing the code to avoid this new forbidden property

I guess that by tomorrow, the new version will be published

Thanks a lot for your patience

[Eduardo Andres Leon]

Dear Manohara, I finally managed to solve your problem. As I said it only appears in perl > 5.23.

In order to test it, you will need to download the code again:

curl -L -O https://bitbucket.org/cbbio/miarma/get/master.tar.bz2
tar -xjf master.tar.bz2
cd cbbio-miarma-*

Once, you can check it by executing : in my case with perl 5.24:

/opt/perl-5.24.0/bin/perl5.24.0 miARma

And you should see something similar to:

#########################################################################
#   miARma, miRNA and RNASeq Multiprocess Analysis                      #
#                miARma v 1.5.1 (Aug-2016)                              #
#                                                                       #
#   Created at Computational Biology and Bioinformatics Group (CbBio)   #
#   Institute of Biomedicine of Seville. IBIS (Spain)                   #
#   Copyright (c) 2016 IBIS. All rights reserved.                       #
#   mail : [e-mail]                                        #
#########################################################################

Usage:

  perl miARma file.ini [options]

Options:

 -check   Instead of running the analysis contained in file.ini, it checks that parameters are correct and then quits.
 -help    Print this help.

As you see there is a new minor version 1.5.1 (Aug-2016).

Then after decomppressing the bowtie1 indexes and the miRNAs example, you can try:

/opt/perl-5.24.0/bin/perl5.24.0 miARma Examples/basic_examples/miRNAs/Known_miRNAs/Known_miRNAs_pipeline.ini

And you will see:

#########################################################################
#   miARma, miRNA and RNASeq Multiprocess Analysis                      #
#                miARma v 1.5.1 (Aug-2016)                              #
#                                                                       #
#   Created at Computational Biology and Bioinformatics Group (CbBio)   #
#   Institute of Biomedicine of Seville. IBIS (Spain)                   #
#   Copyright (c) 2016 IBIS. All rights reserved.                       #
#   mail : [e-mail]                                        #
#########################################################################

[Thu Aug  4 09:52:41 2016] Starting a miARma analysis for miRNA
[Thu Aug  4 09:52:41 2016] Checking provided parameters for: Quality,Adapter,Aligner,ReadCount,DEAnalysis,TargetPrediction. 
[Thu Aug  4 09:52:41 2016] All parameters are correct.
[Thu Aug  4 09:52:41 2016] Starting Quality Analysis.
[Thu Aug  4 09:53:20 2016] Quality Analysis finished.
[Thu Aug  4 09:53:20 2016] Checking if files in folder: "Examples/basic_examples/miRNAs/reads/" are in the correct fastq format.
[Thu Aug  4 09:53:20 2016] Starting a Adapter removal analysis
[Thu Aug  4 09:54:46 2016] Adapter Analysis finished.
[Thu Aug  4 09:54:46 2016] Starting a Post Quality Analysis
[Thu Aug  4 09:55:21 2016] Post Quality Analysis finished.
[Thu Aug  4 09:55:21 2016] Starting a "Bowtie1" Alignment Analysis
[Thu Aug  4 09:55:35 2016] "Bowtie1" Alignment Analysis finished
[Thu Aug  4 09:55:35 2016] Starting a Readcount Analysis
[Thu Aug  4 09:55:39 2016] Readcount Analysis finished.
[Thu Aug  4 09:55:39 2016] Starting a differential expression analysis using EdgeR software(s)
[Thu Aug  4 09:55:43 2016] Differential expression analysis finished.
[Thu Aug  4 09:55:43 2016] Starting a target Prediction Analysis using miRGate
[Thu Aug  4 09:57:03 2016] Target Prediction Analysis finished.
[Thu Aug  4 09:57:03 2016] miARma finished. Job took 4 minutes
[miARma@Fedora miARma]$

Please let me know if you succeeded

[Manoharan]

Dear Eduardo,

I am getting following error.

[Thu Aug 4 23:40:07 2016] Starting a miARma analysis for miRNA [Thu Aug 4 23:40:07 2016] Checking provided parameters for: Quality,Adapter,Aligner,ReadCount,DEAnalysis,TargetPrediction. [Thu Aug 4 23:40:07 2016] All parameters are correct. [Thu Aug 4 23:40:07 2016] Starting Quality Analysis. Use of uninitialized value $encoding in concatenation (.) or string at lib/CbBio/RNASeq/Quality.pm line 292. Use of uninitialized value $gc in concatenation (.) or string at lib/CbBio/RNASeq/Quality.pm line 292. Use of uninitialized value $gc in concatenation (.) or string at lib/CbBio/RNASeq/Quality.pm line 298. Use of uninitialized value $encoding in concatenation (.) or string at lib/CbBio/RNASeq/Quality.pm line 298. Use of uninitialized value $encoding in concatenation (.) or string at lib/CbBio/RNASeq/Quality.pm line 292. Use of uninitialized value $gc in concatenation (.) or string at lib/CbBio/RNASeq/Quality.pm line 292. Use of uninitialized value $gc in concatenation (.) or string at lib/CbBio/RNASeq/Quality.pm line 298. Use of uninitialized value $encoding in concatenation (.) or string at lib/CbBio/RNASeq/Quality.pm line 298. Use of uninitialized value $encoding in concatenation (.) or string at lib/CbBio/RNASeq/Quality.pm line 292. Use of uninitialized value $gc in concatenation (.) or string at lib/CbBio/RNASeq/Quality.pm line 292. Use of uninitialized value $gc in concatenation (.) or string at lib/CbBio/RNASeq/Quality.pm line 298. Use of uninitialized value $encoding in concatenation (.) or string at lib/CbBio/RNASeq/Quality.pm line 298. [Thu Aug 4 23:58:56 2016] Quality Analysis finished. [Thu Aug 4 23:58:56 2016] Checking if files in folder: "/data/analysis/raw_files" are in the correct fastq format. [Thu Aug 4 23:58:56 2016] Starting a Adapter removal analysis CUTADAPT ERROR :: system args failed: 256 (mkdir -p /data/analysis/miARma_output/cutadapt_results/ ; cut_adapt -b AGATCGGAAGAGCACACGTCT -m 15 -M 35 -q 0 /data/analysis/raw_files//A25_raw.fq.gz > /data/analysis/miARma_output//cutadapt_results/A25_raw_cut.fastq 2>> /data/analysis/miARma_output/miARma_stat.65948.log) at lib/CbBio/RNASeq/Adapt.pm line 851.

when comment using # cutadapt lines and try running getting following error.

[Fri Aug 5 00:42:54 2016] All parameters are correct. [Fri Aug 5 00:42:55 2016] Starting Quality Analysis. Use of uninitialized value $encoding in concatenation (.) or string at lib/CbBio/RNASeq/Quality.pm line 292. Use of uninitialized value $gc in concatenation (.) or string at lib/CbBio/RNASeq/Quality.pm line 292. Use of uninitialized value $gc in concatenation (.) or string at lib/CbBio/RNASeq/Quality.pm line 298. Use of uninitialized value $encoding in concatenation (.) or string at lib/CbBio/RNASeq/Quality.pm line 298. [Fri Aug 5 00:43:02 2016] Quality Analysis finished. [Fri Aug 5 00:43:02 2016] Checking if files in folder: "/data/analysis/" are in the correct fastq format. [Fri Aug 5 00:43:02 2016] Starting a Adapter removal analysis 501 Protocol scheme 'http' is not supported

thanks very much for your help.

Regards, mano

[Eduardo Andres Leon]

Could you send the mi miARma_log and miARma_stats files ? They are created in you results folder

Regards

[Manoharan]

Dear Eduardo,

Please find the attached files.

Regards, Manoharan

[Manoharan]

Dear Eduardo,

Please find the attached files. I am attaching the file, some how it is not visible here.

Regards, Manoharan

[Eduardo Andres Leon]

ummm I don't see any file. neither by mail nor in the webpage. Could you try again ?

thanks in advance

[Manoharan]

Dear Eduardo,

Please find the attached file.

Regards, Manoharan

[Eduardo Andres Leon]

Nop, I don't see the log files. Are you uploading them through the webpage ? I guess it does not work as an attached file in an email

[Manoharan]

Dear Eduardo,

I am not able to upload, I have pasted the logs here.

## miARma_logfile

FASTQC :: [Fri Aug 5 12:16:38 2016] Checking /data/analysis/smallRNA/head.fastq for FastQC analysis FASTQC :: [Fri Aug 5 12:16:38 2016] Executing mkdir -p /data/analysis/smallRNA/results/miARma_output/Pre_fastqc_results/ ; fastqc -f fastq -t 24 /data/analysis/smallRNA/head.fastq -o /data/analysis/smallRNA/results/miARma_output/Pre_fastqc_results/ >> /data/analysis/smallRNA/results/miARma_output/miARma_logfile.65948.log 2>&1 Started analysis of head.fastq Approx 5% complete for head.fastq Approx 10% complete for head.fastq Approx 15% complete for head.fastq Approx 20% complete for head.fastq Approx 25% complete for head.fastq Approx 30% complete for head.fastq Approx 35% complete for head.fastq Approx 40% complete for head.fastq Approx 45% complete for head.fastq Approx 50% complete for head.fastq Approx 55% complete for head.fastq Approx 60% complete for head.fastq Approx 65% complete for head.fastq Approx 70% complete for head.fastq Approx 75% complete for head.fastq Approx 80% complete for head.fastq Approx 85% complete for head.fastq Approx 90% complete for head.fastq Approx 95% complete for head.fastq Approx 100% complete for head.fastq Analysis complete for head.fastq CUTADAPT :: [Fri Aug 5 12:16:46 2016] Executing mkdir -p /data/analysis/smallRNA/results/miARma_output//cutadapt_results/ ; cut_adapt -b AGATCGGAAGAGCACACGTCT -m 15 -M 35 -q 0 /data/analysis/smallRNA/head.fastq > /data/analysis/smallRNA/results/miARma_output//cutadapt_results/head_cut.fastq 2>> /data/analysis/smallRNA/results/miARma_output/miARma_stat.65948.log

miarma_stat.log

MINION :: [Fri Aug 5 12:14:47 2016] Adapter prediction for head.fastq sample [minion] reading reads . [minion] connected component analysis [minion] building consensus sequences FASTQCSTATS :: [Fri Aug 5 12:16:46 2016] Name head_fastqc

            Total Sequences:     0   Sequence length:    0

            Encoding:        GCcontent:  %

Traceback (most recent call last): File "./bin/Linux/cutadapt/cut_adapt", line 9, in <module> from cutadapt.scripts import cutadapt File "/apps/cbbio-miarma-3fb1039c9175/bin/Linux/cutadapt/cutadapt/scripts/cutadapt.py", line 74, in <module> from cutadapt.adapters import Adapter, ColorspaceAdapter, BACK, FRONT, PREFIX, ANYWHERE File "/apps/cbbio-miarma-3fb1039c9175/bin/Linux/cutadapt/cutadapt/adapters.py", line 4, in <module> from cutadapt import align, colorspace File "/apps/cbbio-miarma-3fb1039c9175/bin/Linux/cutadapt/cutadapt/align.py", line 225, in <module> from cutadapt.calign import globalalign_locate ImportError: /apps/cbbio-miarma-3fb1039c9175/bin/Linux/cutadapt/cutadapt/calign.so: undefined symbol: PyUnicodeUCS4_DecodeUTF8

Thanks, Mano

[Eduardo Andres Leon]

ok, It seems that you have removed part of the adapter module, but not the most important part, the [Adapter] section. If you don't need a module, you hace to remove/comment everything, including the headers such us [Adapter] or [Aligner] ....

Let me know

[Manoharan]

Now It is working, After commenting the [Adapter]. But why cut_adapt in the tool is not working in my system? and in summary_results_Mouse_miARma.xls report having 0 reads.

Thanks,

[Eduardo Andres Leon]

cut adapt depends on python, this cut adapt version needs at least python 2.7.10 (I’m not sure about python 3, cause they are not compatible)

which python is installed in your system ?

[Manoharan]

I am using 2.7.10 still I am getting this error:

CUTADAPT ERROR :: system args failed: 256

(mkdir -p /data/analysis/results/miARma_output//cutadapt_results/ ; cut_adapt -b AGATCGGAAGAGCACACGTCT -m 15 -M 35 -q 0 /data/analysis///head.fastq > /data/analysis/results/miARma_output//cutadapt_results/head_cut.fastq 2>> /data/analysis/results/miARma_output/miARma_stat.65948.log) at lib/CbBio/RNASeq/Adapt.pm line 851.

[Eduardo Andres Leon]

Could you send me the log and stat file created after executing cut adapt ?

Thanks

[Manoharan]

Dear Eduardo,

Thanks you very much, Adapter trimming is working with reaper, I am getting following error while running DEAnalysis.

Problem while running this R command: print(resultsfiles) Error: print(resultsfiles) : object 'resultsfiles' not found Execution halted

Thanks,

[Eduardo Andres Leon]

That's nice ! Reaper is also faster than cut adapt.

Regarding the R problem. I need to known which version of R and bioconductor are you using.

Regards

[Manoharan]

I am using R (version 3.3.1), Bioconductor (version 2.14).

Thanks,

[Eduardo Andres Leon]

Could you try the following ? And send me your results ?:

$>R

R version 3.2.2 (2015-08-14) -- "Fire Safety"
Copyright (C) 2015 The R Foundation for Statistical Computing
Platform: x86_64-apple-darwin13.4.0 (64-bit)

Inside R:

> source("http://valkyrie.us.es/CbBio/RNASeq/R-Scripts/QC_EdgeR.R")


      #########################################################################  
      QC_EdgeR R function

      Created at Computational Biology and Bioinformatics Group (CbBio)     
      Institute of Biomedicine of Seville. IBIS (Spain)                             
      Copyright (c) 2016 IBIS. All rights reserved.                                   
      mail : [e-mail]                                                     
      #########################################################################


      Get help typing QC_EdgeR_help()

Then:

> list.of.packages <- c("ggplot2", "Rcpp","edgeR","NOISeq","gplots","lattice","genefilter","RColorBrewer")

> lapply(list.of.packages, require, character.only = TRUE)
Loading required package: ggplot2
Need help? Try the ggplot2 mailing list: http://groups.google.com/group/ggplot2.
Loading required package: Rcpp
Loading required package: edgeR
Loading required package: limma
Loading required package: NOISeq
Loading required package: Biobase
Loading required package: BiocGenerics
Loading required package: parallel

Attaching package: ‘BiocGenerics’

The following objects are masked from ‘package:parallel’:

    clusterApply, clusterApplyLB, clusterCall, clusterEvalQ,
    clusterExport, clusterMap, parApply, parCapply, parLapply,
    parLapplyLB, parRapply, parSapply, parSapplyLB

The following object is masked from ‘package:limma’:

    plotMA

The following objects are masked from ‘package:stats’:

    IQR, mad, xtabs

The following objects are masked from ‘package:base’:

    Filter, Find, Map, Position, Reduce, anyDuplicated, append,
    as.data.frame, as.vector, cbind, colnames, do.call, duplicated,
    eval, evalq, get, grep, grepl, intersect, is.unsorted, lapply,
    lengths, mapply, match, mget, order, paste, pmax, pmax.int, pmin,
    pmin.int, rank, rbind, rownames, sapply, setdiff, sort, table,
    tapply, union, unique, unlist, unsplit

Welcome to Bioconductor

    Vignettes contain introductory material; view with
    'browseVignettes()'. To cite Bioconductor, see
    'citation("Biobase")', and for packages 'citation("pkgname")'.

Loading required package: splines
Loading required package: Matrix

Attaching package: ‘NOISeq’

The following object is masked from ‘package:edgeR’:

    rpkm

Loading required package: gplots

Attaching package: ‘gplots’

The following object is masked from ‘package:stats’:

    lowess

Loading required package: lattice
Loading required package: genefilter

Attaching package: ‘genefilter’

The following object is masked from ‘package:base’:

    anyNA

Loading required package: RColorBrewer

Finally:

> sessionInfo()
R version 3.2.2 (2015-08-14)
Platform: x86_64-apple-darwin13.4.0 (64-bit)
Running under: OS X 10.11.6 (El Capitan)

locale:
[1] C/UTF-8/C/C/C/C

attached base packages:
[1] splines   parallel  stats     graphics  grDevices utils     datasets 
[8] methods   base

other attached packages:
 [1] RColorBrewer_1.1-2  genefilter_1.52.0   lattice_0.20-33    
 [4] gplots_2.17.0       NOISeq_2.14.0       Matrix_1.2-3       
 [7] Biobase_2.30.0      BiocGenerics_0.16.1 edgeR_3.12.0       
[10] limma_3.26.3        Rcpp_0.12.2         ggplot2_1.0.1

loaded via a namespace (and not attached):
 [1] AnnotationDbi_1.32.2 magrittr_1.5         IRanges_2.4.5       
 [4] MASS_7.3-45          munsell_0.4.2        xtable_1.8-0        
 [7] colorspace_1.2-6     stringr_1.0.0        plyr_1.8.3          
[10] caTools_1.17.1       tools_3.2.2          grid_3.2.2          
[13] gtable_0.1.2         KernSmooth_2.23-15   DBI_0.3.1           
[16] gtools_3.5.0         survival_2.38-3      digest_0.6.8        
[19] reshape2_1.4.1       S4Vectors_0.8.4      bitops_1.0-6        
[22] RSQLite_1.0.0        gdata_2.17.0         stringi_1.0-1       
[25] scales_0.3.0         stats4_3.2.2         XML_3.98-1.3        
[28] annotate_1.48.0      proto_0.3-10

[Manoharan]

Dear Eduardo,

Is there option for adapter trimmed fasta as input file for Denovo miRNA and Known miRNA analysis.

Thanks,

[Eduardo Andres Leon]

Yes, if you take a look to the ini file provided inside the Denovo example, you can provide your adapter sequence in order to be removed. But, as the software used for the novo prediction, has its own way to remove the adapter, you don`t need to use the [Adapter] section :

[DeNovo]
;Indexed genome to align your reads in format .ebwt (Mandatory for analysis with miRDeep)
bowtie1index=Genomes/Indexes/bowtie1/human/bw1_homo_sapiens19
;Adapter to trimm
adapter=ATCTCGTATGCCGTCTTCTGCTTGAA
;a fasta file with all mature sequence from your organism
mature_miRNA_file=Examples/basic_examples/miRNAs/data/hsa_mature_miRBase20.fasta
;a fasta file with all known pre-miRNa sequence
precursor_miRNA_file=Examples/basic_examples/miRNAs/data/precursors_miRBase20.fasta
;fasta file for the cmplete genome of our organism
genome=Genomes/Indexes/bowtie1/human/homo_sapiens19.fa

[Manoharan]

I tried only fasta file as input in the read dir for Denovo identification. (input filename: S_I_C_clean2.fasta) I got following error.

[Wed Aug 10 16:07:38 2016] All parameters are correct. [Wed Aug 10 16:07:38 2016] Starting a De novo identification and quantification of miRNAs Can't find miRDeep results (Examples/basic_examples/miRNAs/DeNovo_miRNAs/results_osa4//miRDeep_results/) [Wed Aug 10 16:07:38 2016] De novo identification and quantification of miRNAs finished

[Eduardo Andres Leon]

Please could you send me the logs files (miARma-log and miARma-stat). As a recommendation, file extension depending on the software are quite important. So I encourage you to use fastq or fq instead of fasta (cause both format are different) from your input files.

Regards

[Manoharan]

Dear Eduardo,

Sorry for the delay in reply, The log files are empty. As you suggested I will prefer to use fastq files only.

Did you get a chance to look the R log file I sent you (regarding DEAnalysis error).

Thanks,

[Eduardo Andres Leon]

Without log files I can’t see what is happening. May be they were overwritten ? In that case It is better to run the pipeline again. There should be a line similar to this :

resultsfiles<-   QC_EdgeR(projectdir="/home/miARma/miARma/Examples/basic_examples/miRNAs/Known_miRNAs/results",dir="/home/miARma/miARma/Examples/basic_examples/miRNAs/Known_miRNAs/results/Readcount_results", file="cut_bw1-ReadCount.tab", targetfile="/home/miARma/miARma/Examples/basic_examples/miRNAs/data/targets.txt",label="Hypoxia_cut_bw1", filter="yes”)

Once you find it, what you have to do is to run it from a manual R session:

that is (inside of the Readcount_results folder):

$>R
>source("http://valkyrie.us.es/CbBio/RNASeq/R-Scripts/QC_EdgeR.R”)
>QC_EdgeR(projectdir="/home/miARma/miARma/Examples/basic_examples/miRNAs/Known_miRNAs/results",dir="/home/miARma/miARma/Examples/basic_examples/miRNAs/Known_miRNAs/results/Readcount_results", file="cut_bw1-ReadCount.tab", targetfile="/home/miARma/miARma/Examples/basic_examples/miRNAs/data/targets.txt", label="Hypoxia_cut_bw1", filter="yes")

(the last line is the one you obtain in your log file, but removing : "results files<-“)

Let me know

[Manoharan]

Dear Eduardo,

I am getting following error.

QC_EdgeR(projectdir="/apps/cbbio-miarma-3fb1039c9175/Examples/basic_examples/miRNAs/DeNovo_miRNAs/results",dir="/apps/cbbio-miarma-3fb1039c9175/Examples/basic_examples/miRNAs/DeNovo_miRNAs/results/DeNovo_ReadCount", file="miRNAs.tab", targetfile="/data/analysis/smallRNA/results/targets1.txt", label="Hypoxia_miRNAs", filter="yes")

Error in order(targets$Filename) : argument 1 is not a vector

##Target1.txt Name\tType\n Control\tUntreated\n W12\tTreated\n

Thanks,

[Eduardo Andres Leon]

Dear Manoharan, Your target1.txt file is not following miARma requirements. If you look in our provided example, the first column must be called "Filename". Name is not valid as a first column header.

Filename        Name    Time
SRR873382       Norm_1  T0h
SRR873383       Norm_2  T0h
SRR873384       Hyp_16_1        T16h
SRR873385       Hyp_16_2        T16h

[Manoharan]

My bad Thanks very much.

[Eduardo Andres Leon]

No problem. Should I close the issue ?

[Manoharan]

Yes. Thanks.

[Manoharan]

Dear Eduardo,

does the target prediction step works for mouse, human and rat organism only? does it work for plants?

Thanks, Manoharan

[Eduardo Andres Leon]

Dear Manoharan, I'm sorry to say that the answer to your question is no. For the prediction of targets, miARma uses miRGate (http://www.ncbi.nlm.nih.gov/pubmed/25858286). When developing miRGate, I did thinking mainly in cancer experiments (while working at CNIO, I only received tumor samples).

Sorry again, kind regards

[Manoharan]

Dear Eduardo,

I have doubt regarding miARma-seq, if one wants to find out both Known and novel miRNA, what they should do?

should they have to run Known pipeline separately and novel separately ? or one can directly use the novel mirna pipeline?

Regards, Manoharan

[Eduardo Andres Leon]

Dear Manoharan,

It's nice to "see" you again. My recomendation is to do it separately: miRDeep has special requirements that are only applicable to miRDeep, as a result, part of the processed data are only valid for miRDeep (I mean, if you want to remove the adapter, there is a special way to do inside mirdeep which is different from the module used in known miRNAs, so that means that this adapterREmoval must be run twice, so it doesn't worth it).

Besides, log files and results folders will contain both results and I think this can be a mess.

So, It's better to perform a known pipeline and store the output in one folder and then, perform a novel pipeline storing the output in a diffrent output folder.

Regards

[Manoharan]

Dear Eduardo,

Thank you very much quick reply. when we do novel mirna pipeline it also provides known mirna counts as well so should we have to ignore them? and for the predicted the novel mirna true positive score is <30 for all my samples from different organisms. is it possible to get this scores or something wrong with the analysis or data?

thanks,

Regards, manohar

[Manoharan]

sorry i missed one more doubt, how one can get novel mirna structure from novel mirna pipleline?

thanks,

[Eduardo Andres Leon]

Dear Manoharan, Regarding your previous question, I did not understand correctly your question, it's true that the novel pipeline offers known miRNA. Our comparison, among these results and the ones provided by the "standard" pipeline are different somehow. So I rather use the known pipeline and ignore the results obtained by miRDeep for these known miRNAs.

Regarding the score. I guess that you are talking about the xls files inside the miRDeep_results folder. The scores under the section called "mature miRBase miRNAs detected by miRDeep2" should be >30. Are you providing the mature.fa file for each organism ? mixing organism ?

And finally, regarding the structure. Most of the results by miRdeep are "deleted" by miARma. Another user proposed to build some PDF and HTMLs files and I'm working on it. So I'll keep also the structure information. In the meantime, you can comment the lines 2219 and 2220 in the Aligner.pm library. In such a way, all folders created by miRdeep will be preserved and you will be able to use the structure information

Regards

[Manoharan]

Dear Eduardo,

Thanks you cleared all my queries.

Regarding Are you providing the mature.fa file for each organism ? mixing organism ? Here for mature.fa I am using the mature.fa for corresponding organism. for instance oryza sativa means I am using osa.mature.fa file.

Thanks,

Regards, Manoharan

[jaes_suze]

Hi

I have issue regading my installation, wince i get this error, please advise me

./miARma miARma Examples/basic_examples/miRNAs/Known_miRNAs/Known_miRNAs_pipeline.ini Can't locate CbBio/RNASeq/miARma.pm in @INC (you may need to install the CbBio::RNASeq::miARma module) (@INC contains: >$miARmaPath,/lib/Perl >$miARmaPath,/lib/ /home/avenger/Downloads/psRobot_v1.2/perllib /etc/perl /usr/local/lib/perl/5.18.2 /usr/local/share/perl/5.18.2 /usr/lib/perl5 /usr/share/perl5 /usr/lib/perl/5.18 /usr/share/perl/5.18 /usr/local/lib/site_perl .) at ./miARma line 82. BEGIN failed--compilation aborted at ./miARma line 82.

[Eduardo Andres Leon]

Dear jaes_suze, Thank you for using miARma!

I'd like to ask you to create your own issue, this was already solved and your problem could be a different one. By creating a new issue, we can help other users.

Then, in order to help you, I need some information:

• Operative system
• Perl version

Kind regards Edu