501 Protocol scheme 'http' is not supported
Hello,
I am doing miRNA analysis and the program worked fine until the adapter removal
[Thu Mar 30 14:03:20 2017] Starting a miARma analysis for miRNA [Thu Mar 30 14:03:20 2017] Checking provided parameters for: Quality,Adapter,Aligner,ReadCount,DEAnalysis,TargetPrediction. [Thu Mar 30 14:03:20 2017] Checking General-output_dir parameter ... Exists! [Thu Mar 30 14:03:20 2017] The folder specified in (output_dir=xxxxx/miARmaSeq_TEST_300317) already exists. [Thu Mar 30 14:03:20 2017] Wait 5 seconds to overwrite the folder. Cancel otherwise: 0 [Thu Mar 30 14:03:26 2017] Continue. [Thu Mar 30 14:03:26 2017] All parameters are correct. [Thu Mar 30 14:03:26 2017] Starting Quality Analysis. [Thu Mar 30 14:26:34 2017] Quality Analysis finished. [Thu Mar 30 14:26:34 2017] Checking if files in folder: "xxxxx/fastq" are in the correct fastq format. [Thu Mar 30 14:26:34 2017] Starting a Adapter removal analysis
Then I received an error "501 Protocol scheme 'http' is not supported", which is probably a Perl error.
Comments (14)
-
-
[General] ; type of analysis (miRNA, mRNA or circRNA) type=miRNA ; Complete path where your raw reads are stored read_dir=xxxxx/fastq ; label for the analsysis label=TEST_300317 ; Complete path where miARma has been installed miARmaPath=/site/app7/miARma-1.5 ; Complete path to store results output_dir=xxxxx/miARmaSeq_TEST_300317 ; organism used (common name eg: mouse, fruitlfy, yeast ...) organism=human ; Number of processes to run at the same time (adjust this value according to your hardware infrastructure and needs) threads=12 [Quality] ; Select when quality should be performed (Previous to adapter removal, Post adapter process or both. Pre by default) ; Check section 4.1.2.2 from miRNA documentation for more details prefix=pre [Adapter] ; Specific software to remove the adapter from the sequences, CutAdapt by default adaptersoft=CutAdapt ; if no adapter sequence is provided, it will predict an adapter to be removed. [Aligner] ; Aligner to use with miRNA (Bowtie1, Bowtie2, BWA or miRDeep) aligner=Bowtie1 ; Absolute path to Bowtie indexes files bowtie1index=xxxxx/BowtieIndex/genome [ReadCount] ; Absolut path to GFF file used to calculate the number of reads in featureCounts analysis database=xxxxx/genes.gtf ; GFF attribute to be used as feature ID (default: gene_id) for featureCounts analysis seqid=transcript_id ; Feature type (3rd column in GFF file) to be used, all features of other type are ignored (default:exon) for featureCounts analysis featuretype=miRNA [DEAnalysis] ; Absolute path of the target file where group of sampes is detailed. targetfile=xxxxx/sampleInfo.txt ; Complete path of the contrast file where the comparison is specified (eg: Tumor-Health). contrastfile=xxxxx/contrastfile.txt [TargetPrediction]
-
Hi Matti, As I see you are using CutAdapt and you are not providing the adapter sequence, so as I suspected, Minion is predicting an adapter for you. First, if your reads are already trimmed, you should avoid the Adapter section. If on the contrary, you need to trimm the sequence but you don't know the adapter sequence, you have to make sure that your computer is able to connect to the blat server in the UCSC web page (https://genome.ucsc.edu/cgi-bin/hgBlat). A week ago another user had a similar problem due to his university proxy policy
Finally, I guess you are using miARma1.5 (as I see in your ini file). We are now serving the 1.6.1 version
Let me know
-
As you can see, my reads have adapters, so I do need to trim them. Ok I will check the other things you suggested. Thank you.
-
Ufff yes, you have to trim for sure. So my recommendation is first ask for the adapter (the genomics core souled provide you). If your reads come from GEO/SRA, then Minion is what you need, but you should check your network policy
-
Hello,
The adapter has got these properties:
Name Sequence Strand 3'Adapter (RA3) RC (Illumina) CCTTGGCACCCGAGAATTCCA Minus
So how do I use it in the pipeline instead of using Minion?
Thank you.
-
Hi, You only need to add the adapter key and the value, for example:
[Adapter] ; Specific software to remove the adapter from the sequences, CutAdapt by default adaptersoft=CutAdapt ; Adapter sequence to be removed. adapter=CCTTGGCACCCGAGAATTCCA
You can check more examples at /site/app7/miARma-1.5/Examples/basic_examples/miRNAs/Known_miRNAs/
Regards
-
The next error is:
Problem while running this R command: source("http://valkyrie.us.es/CbBio/RNASeq/R-Scripts/AdapterGraph.R") AdapterGraph("xxxxx/miARmaSeq_TEST_300317/cutadapt_results/", "xxxxx/miARmaSeq_TEST_300317/cutadapt_results/yyyyyy_cut.fastq.lane.report.clean.len", "yyyyyy_cut") Error: plot.window(xlim, ylim, log = log, ...) : need finite 'xlim' values Calls: AdapterGraph -> barplot -> barplot.default -> plot.window In addition: Warning messages: 1: In min(w.l) : no non-missing arguments to min; returning Inf 2: In max(w.r) : no non-missing arguments to max; returning -Inf 3: In max(readvalues) : no non-missing arguments to max; returning -Inf 4: In max(readvalues) : no non-missing arguments to max; returning -Inf Execution halted
These files in cutadapt_results are almost empty:
[cutadapt_results]$ du -sh * 0 yyyyy_cut.fastq 4,0K yyyyy_cut.fastq.lane.report.clean.len 4,0K Reads_histogram_of_yyyyy_cut.pdf
-
Ummm you should update to the latest miARma version, the source command to valkyrie.us.es give us a lot of errors. So in latest version, all R code is locally installed
regards
-
And, by the way. Take a look to the summary excel file, it seems that your adapter sequence could be wrong
Edu
-
Yes I updated the software and it didn't help. The summary excel doesn't show anything after Pre_fastqc_results. And I think that this adapter is correct, because it worked with another program that was used, i.e. this https://www.qiagenbioinformatics.com/products/clc-genomics-workbench
-
could you send the log and the stat file ?
Thanks
-
Actually you were right: the adapter was wrong. I used Trim Galore! to autodetect the adapter and remove it, and the summary says:
Adapter sequence: 'TGGAATTCTCGG' (Illumina small RNA adapter; auto-detected) Total reads processed: 27,640,945 Reads with adapters: 25,643,323 (92.8%) Reads written (passing filters): 27,640,945 (100.0%)
So I will use this sequence instead and see what happens. Thank you very much for your fast replies.
-
- changed status to resolved
Solved using Ilumina small RNA adapter
- Log in to comment
Hi, could you paste the ini file ? I guess you are using Minion to predict an adapter (which uses a blat server over http).