error while running miARMA

[FARHA RAMZAN]

while running miARMA I am encountering following error

/lib/ /etc/perl /usr/local/lib/perl/5.18.2 /usr/local/share/perl/5.18.2 /usr/lib/perl5 /usr/share/perl5 /usr/lib/perl/5.18 /usr/share/perl/5.18 /usr/local/lib/site_perl .) at ./miARma line 82. BEGIN failed--compilation aborted at ./miARma line 82.

Could you please help me with this problem

[FARHA RAMZAN]

I am using Linux and have installed docker for miARma

[Eduardo Andres Leon]

Dear Farha, That its really strange. These docker images were tested and updated yesterday. Which docker image did you use ?

And more importantly, if you are using a linux machine, why don't you use the "source" installation ? That means to install R and bioconductor and download a single bundle. This is the recommended installation.

Eduardo

[FARHA RAMZAN]

Hey Eduardo, Thank you for your response.

As suggested by you, i installed the source miARma and it started working smoothly but just after finishing the quality analysis it is showing error

500 Can't connect to genome.ucsc.edu

http://genome.ucsc.edu:80

I guess it is related to proxy access and i have contacted my network office, hope this should be fixed.

Cheers Farha

[Eduardo Andres Leon]

Hi Farha, You are right, all users experiencing this error were under restrictive proxies.

As you are using minion (which is the only one module that connects to genome.ucsc), I guess that you need to remove an unknown adaptor sequence in you miRNA analysis ¿?

Edu

[FARHA RAMZAN]

Hey Edu

thank you for your response, but i dont understand what exactly you mean by unknown adapter, as much i know our data has truseq 3' adapter. Do you mean to say thats unknown.

i would highly appreciate your response

Cheers Farha

[Eduardo Andres Leon]

Hi. That is why I asked you the question ;)

For a miRNA analysis, you have to provide the adapter sequence cause this must be removed. Any genomic facility usually provides this information. But, if you are using SRA/EGA files, this information is often missing. In this cases, minion is able to predict an adapter sequence.

If this is not your case and you know the adapter sequence used in your experiment, you should provided as in this example:

[Adapter]
; Adapter sequence to be removed in the analysis
adapter=ATCTCGTATGCCGTCTTCTGCTTGAA
; Specific software to remove the adapter from the sequences
adaptersoft=CutAdapt

[FARHA RAMZAN]

Hey Edu

Thank you so much for your response.

i now edited my ini file, hopefully it works.

Cheers Farha

[FARHA RAMZAN]

Hey Edu,

Greetings!

while performing my analysis, i am encountering this error.i would highly appreciate your help.

[Thu Jul 13 01:00:05 2017] Starting a Readcount Analysis SEQCOUNT ERROR :: system args failed: 65280 (mkdir -p /data/programs/my_results//cut_bw1_readcount_results/ ;featureCounts -s 1 -t miRNA -g transcript_id -T 4 -a /data/reference_data/gencode/gencode.v19.annotation.gtf -o /data/programs/my_results//cut_bw1_readcount_results/22-2_S3_L001_R1_001_cut_bw1.tab /data/programs/my_results//Bowtie1_results/22-2_S3_L001_R1_001_cut_bw1.bam 2>> /data/programs/my_results/miARma_logfile.12778.log) at /data/miARma1.6.1//lib/CbBio/RNASeq/Readcount.pm line 202, <STAT> line 15291.

Cheers Farha

[Eduardo Andres Leon]

Could you include your log files ? (miARma_log and miARma_stat )?

And secondly, has you check that you GTF and your index are using the same coordinates labelling ? (chr1 vs 1 )?

Edu

[FARHA RAMZAN]

Kindly find attached files.

[FARHA RAMZAN]

how can i check if my GTF file and index are same coordinates labelling.

[FARHA RAMZAN]

i have downloaded bowtie index and GTF file earlier separately. would you recommend any particular site to download or it can be downloaded altogether from this http://miarmaseq.cbbio.es/download/Genome/Index_bowtie1_hg19.tar.bz2.

Kind Regards Farha

[FARHA RAMZAN]

Hey Edu

greetings!

i checked both my reference and GTF file use chr1 However i know my GTF downloaded from ftp://ftp.sanger.ac.uk/pub/gencode/Gencode_human/release_19/gencode.v19.annotation.gtf.gz lists miRNA under transcript_type and not in the 3rd column as the miARMA documentation suggests. i was using ; Feature type (3rd column in GFF file) to be used, all features of other type are ignored (default:exon) for featureCounts analysis featuretype=miRNA.

what option do i select for miARMA to select miRNA from GTF?

I would highly appreciate your response

Cheers Farha

[Eduardo Andres Leon]

Dear Farha. I guess the log files are not the correct ones because the date are from Jul 8 11:58:28. In this file I only see a minion error. Previous error

Regarding the GFT and index. miARma provides the GTF and the bowtie indexes, both from GCRh37. The first one is included in the miRNA file analysis: https://sourceforge.net/projects/miarma/files/Examples/Examples_miARma_miRNAs.tar.bz2 (inside a folder called data) and the second one in the link you mention earlier: http://miarmaseq.cbbio.es/download/Genome/Index_bowtie1_hg19.tar.bz2 That would be the easier way because it is tested.

You can also download the human genome in fasta format and you can create your one indexes using miARma. In this case I recommend you to use Ensemble fasta files (one for each chromosome, so you have to merge them). In the case of miRNAs, I always recommend to relay in miRBase. They provide the most accurate annotation files: miRNAs GRCh38: ftp://mirbase.org/pub/mirbase/CURRENT/genomes/hsa.gff3 and GRCh37: ftp://mirbase.org/pub/mirbase/20/genomes/hsa.gff3 . The next step is to convert those GFF files in GTF file. In this case I use the tool gffread (http://ccb.jhu.edu/software/stringtie/gff.shtml). An example would be: gffread my.gff3 -T -o my.gtf

Kind regards

[FARHA RAMZAN]

Thank you so much for writing back to me Edu I downloaded both GTF and index from the recommended website in miARMA documentation that's https://sourceforge.net/projects/miarma/files/Examples/Examples_miARma_miRNAs.tar.bz2 and http://miarmaseq.cbbio.es/download/Genome/Index_bowtie1_hg19.tar.bz2.

For denovo analysis human genome (hg19) from http://miarmaseq.cbbio.es/download/Genome/hg19_genome.tar.bz2

Fingers crossed it will run this time. Thank you once again for being such a great help :-)

Kind Regards Farha Ramzan

[Eduardo Andres Leon]

It is pleasure. Bt the way, the genome hg19 is also included in the bowtie1 index (or that is what I remember). So you don't need to download it twice.

Edu

[FARHA RAMZAN]

Hey Edu,

Greetings!

Now a new problem, Analysis again stopped at Starting a differential expression analysis using EdgeR software(s) Problem while running this R command: print(resultsfiles) Error: print(resultsfiles) : object 'resultsfiles' not found Execution haltedn

i have checked and updated all the software needed, in bio-conductor package. and started again, hope it works

Farha

[Eduardo Andres Leon]

I'm glad to hear that the most difficult part is already done. The DEAnalysis is the "most" difficult section according with the number of issues. The format of the target.txt and contrast.txt files is behind of the 90% of the errors, so please check them

Edu

[FARHA RAMZAN]

Hey Edu,

Greetings!

As I mentioned previously, I was encountering an error with DE Analysis and after installing all the required bioconductor software I restarted the analysis, but unfortunately It again stopped at same point

Analysis again stopped at Starting a differential expression analysis using EdgeR software(s) Problem while running this R command: print(resultsfiles) Error: print(resultsfiles) : object 'resultsfiles' not found Execution halted

I have attached the log and stat files. I would highly appreciate your help.

Cheers Farha

[FARHA RAMZAN]

Hey Edu,

Greetings!

it seems everything is working properly, you were right it was the target and contrast files which were halting the analysis.

Now as everything seems to be working i started the analysis once again from the beginning.

I have a question, as if i didn't ask enough before :-)

How can i access normalized Read-count files, as i want to generate heat-maps from the normalized data.

Thank you so much for assisting me.

Cheers Farha

[Eduardo Andres Leon]

Hi Farha, sorry for the delay but I.ve been out of the office.

You can get cpm (normalised reads) and RPKM (~ expression values) using cpm=yes and rpkm=yes in the [DEAnalysis] section. If both parameters were already included, you will find both files in EdgeR_results folder. By the way, miARma creates those heat maps for you, they are also included in the edgeR folder.

Please let me know

Edu

[FARHA RAMZAN]

Hey Edu,

Thank you for the information . you are right, in EdgeR_Results, i can see heat maps for 250 DE miRNA. but what i want is heat maps for the significant miRNAs, that is why i am aiming for the normalized Read-count.

Cheers Farha

[FARHA RAMZAN]

Hey Edu,

Greetings!

Thank you so much for you help in using miARMA.

i have successfully analysed my sequencing data,

i have a quick question. Can i analyse precursor miRNA in miARMA?

Cheers Farha Ramzan

[Eduardo Andres Leon]

Hi !!!! Yes you can. miARma includes miRDeep2 which is intended to analysis precursor miRNAs to identify new miRNAs. I'm not an expert in miRDeep2, but take a look at our examples included in the DeNovo_miRNAs folder

Edu