Add a way to modify miRDeep2 parameters

[Sebastien]

Hello, I'm using miARma-seq to analyze miRNA data. I'm wondering if you will add the possibility to modify miRDeep2 parameters like the number of precursors it can analyse?

Have a nice day Sebastien

[Eduardo Andres Leon]

Hi sebastien, I was wondering if a miRDeeparams parameter is enough for you. I don't know if you have used the miARma examples, but all aligners include a "param" parameter (e.g. bwaparams, bowtie2params), to include additional values that are added to aligner execution

I'm not an expert in miRdeep so I'm not sure. Let me know if this is enough and I can give you access to a pre-release including this option, for you to test

Edu

[Sebastien]

Hi Eduardo, I used the bowtieparameters options already and I think it enough to use miRDeep2. In the miRDeep2 documentation, there is a -g int option. This option let you decide the number of precursors you want to analyse and this is this option I would like to test.

I'll finish my internship tomorrow but I can test the pre-release if it can help you. I have a Ubuntu machine at home. I think it's enough to run miARma.

Sebastien

[Eduardo Andres Leon]

Hi Sebastien, Sorry to hear about that, I hope you can still use miARma.

I've created a new 1.7.1 version fixing some bugs and adding the parameter you need. It is called miRDeeparameters. So you can now include parameters like this:

[DeNovo]
;Indexed genome to align your reads in format .ebwt (Mandatory for analysis with miRDeep)
bowtie1index=Genomes/Indexes/bowtie1/human/bw1_homo_sapiens19
;Adapter to trimm at read 3'
adapter=ATCTCGTATGCCGTCTTCTGCTTGAA
;a fasta file with all mature sequence from your organism
mature_miRNA_file=Examples/basic_examples/miRNAs/data/hsa_mature_miRBase20.fasta
;a fasta file with all known pre-miRNa sequence
precursor_miRNA_file=Examples/basic_examples/miRNAs/data/precursors_miRBase20.fasta
;fasta file for the cmplete genome of our organism
genome=Genomes/Indexes/bowtie1/human/homo_sapiens19.fa
;parameters to miRDeep2 binary (just an example)
miRDeeparameters=-g 150

This value (in this case -g 150) is added to miRDeep2.pl program. Let me know if this is correct or, however, this parameters has to be included in the mapper.pl program

You can download the new version from: https://bitbucket.org/cbbio/miarma/get/master.tar.bz Edu

[Sebastien]

Hi Eduardo, Yeah that's it! I think it can be very usefull for miARma-seq users :) I can use miARma-seq but as I'm no more in internship it will be on my free time. If I do some tests for you, would you mind maybe citing me on your website for doing some tests or something like that?

By the way you did a vrey nice tool and I was very happy to use it during my internship.

Greets Sebastien

[Eduardo Andres Leon]

Of course !!! I have to update the web page to include the hisat and star aligners (and some examples) and also the documentation. So count on it

Edu

[Sebastien]

It'll try to test it ;) I think I'll try different miRDeep2 parameters to test if all go well

Sebastien

[Eduardo Andres Leon]

That could me fantastic !

Thanks in advance

[Sebastien]

Hi Eduardo. Sorry for taking time with the tests, I was moving out last week and doing some papers. I tried to run miARma-seq with the miRDeeparam line but it seems to not work correctly.

I'll try to attach the config file and the log and stats files. In the stat file I don't see the -g option in the command that execute miRDeep2.

[Sebastien]

Config file I used

[Sebastien]

Stat file and log file

[Sebastien]

Stat file and log file

[Eduardo Andres Leon]

Hi Sebastien, As I see in you ini file you are no using the correct parameter. According with my example above, you should use: miRDeeparameters=-g 1000

[Sebastien]

Hi Eduardo, Maybe I'm doing something wrong with miRDeep, but it seemes here again that the miRDeeparameters=-g 1000 do not work correctly.

Sebastien

[Eduardo Andres Leon]

miRDeeparameters added in September 2017