1. CBBIO Avatar CBBIO
  2. Untitled project
  3. miARma
  4. Issues

R2 mate pair cutadap output has not read

Issue #90 closed
Didier Croes created an issue

Hi,

Using the last release of miarma on mate pair fastqs R1 and R2 located in the same directory, I noticed that the output fastq of R2 is empty and the clean.len file contains only the header columns.

Can you please help?

kind regards

Didier

Comments (20)

  1. Eduardo Andres Leon

    Dear Didier, Thanks for using miARma.

    That sounds weird ... Could you send me your logs files (miARma_log and miARma_stats) + your ini file ?

    Thanks

  2. Didier Croes reporter

    Hi Edouardo,

    thank you for your reply.

    I replied to the mail I recieved but, as didn't get any news from you, I wonder if you recieved the message. If it's the correct way to do, I don't see any way to send attachment. Maybe I can copy the file content in the mail body but it will be long.

    What is the best way to send you the files?

    kind regards

    Didier

  6. Eduardo Andres Leon

    Hi Didier, As you may notice, I did not receive any mail until today.

    In order to attach files you have to click in the "more" button on the right part of the web page:

    To add attachments to an existing issue, open the issue and follow these steps: Click more () > Attach files. Add a file(s). Click Attach or Open. You can also drag and drop files onto an issue to attach them.

  8. Eduardo Andres Leon

    received .... First question ... is TGGAATTCTCGGGTGCCAAGG the adapter used by your genomic core ?

  10. Eduardo Andres Leon

    Yes, I see it in the log file. First, we will start using the best option in your case, I mean using the adapter:

     [Adapter]
 adapter=TGGAATTCTCGGGTGCCAAGG
 adaptersoft=Cutadapt
 min=1
 max=50

    If you have tested the above configuration and it failed .... my first question is ... is cutadapt installed in your computer ? (miARma has it own cut adapt which has been tested)

  11. Didier Croes reporter

    Yes I have cutadapt on my system but I think it uses the one of miarma. It work on the R1 so I guess this is not the issue.

  13. Eduardo Andres Leon

    I have a question. Is the adapter used for R1 and R2?

    Yes, It is used for all files included in read_dir

    Yes I have cutadapt on my system but I think it uses the one of miarma. It work on the R1 so I guess this is not the issue.

    That is not really true. I had this problem with other user and after 1 month testing things she renamed the cutadapt installed in the system and then everything worked correctly. Could you try it ?

  15. Didier Croes reporter

    now it works when I comment out the ";adapter=TGGAATTCTCGGGTGCCAAGG"

    when I uncomment it "adapter=TGGAATTCTCGGGTGCCAAGG" I get the following error:

    roblem while running this R command: source("/nexus/software/miarma/cbbio-miarma-978bff953ed7//lib/CbBio/RNASeq/R-Scripts/AdapterGraph.R") AdapterGraph("/nexus/RNAseq/170811_D00823_0030_BCBD7UANXX_NB021/None-mi-hs-FD1-MCF7-PAGE_S85/results/cutadapt_results/", "/nexus/RNAseq/170811_D00823_0030_BCBD7UANXX_NB021/None-mi-hs-FD1-MCF7-PAGE_S85/results/cutadapt_results/None-mi-hs-FD1-MCF7-PAGE_S85_R2_001_cut.fastq.lane.report.clean.len", "None-mi-hs-FD1-MCF7-PAGE_S85_R2_001_cut")

    Error: plot.window(xlim, ylim, log = log, ...) : need finite 'xlim' values Calls: AdapterGraph -> barplot -> barplot.default -> plot.window In addition: Warning messages: 1: In min(w.l) : no non-missing arguments to min; returning Inf 2: In max(w.r) : no non-missing arguments to max; returning -Inf 3: In max(readvalues) : no non-missing arguments to max; returning -Inf 4: In max(readvalues) : no non-missing arguments to max; returning -Inf Execution halted

  16. Eduardo Andres Leon

    Glad to hear that. Could you send me your summary.xls file ? (it should be inside the output_folder)

    Regards

  21. Log in to comment
Assignee
–
Type
bug
Priority
major
Status
closed
Votes
0
Watchers
1
Jira: the preferred issue tracker for Bitbucket. Join the team!