Why there have repeat seqid and 0 in template column of frag_raw file？

[li chen]

ACTGGCTGCGCCGCAGCGGCAGCAGTTTGTTGATTGGCTAAAGGGAAACACGACCGGCAACCACCGCATCCGCGCGGCGGTGCCGGCAGACTGGGCAGTCGGAGACAAAACCGGAACCTGCGGAGTGTATGGCACGGCAAATGACTATGCCGTCGTCTGGCCCACTGGGCGCGCACCTATTGTGTTGGCCGCCTACACCCGGGCGC 12 203 24,24,24,24,24,24,24,24,24,24,24,24 230,230,230,230,230,230,230,230,230,230,230,230 21,22,23,24,25,26,27,28,29,37,29,37

like this，the template column have two 29，37； the start and end position are consistent.

Is this right?

‌

[ptlcc]

Hi Li

It depends a bit on the version (can be checked with: kma -v) and options used when running kma.
Is it a public database, or can I get you to send that too. Then I will try to recreate and possibly solve the issue.

Best,
Philip

[li chen]

  <div class="preview-container wiki-content"><!-- loaded via ajax --></div>
  <div class="mask"></div>
</div>

</div> </form>

[li chen]

Thank you for reply.

1. ‌ I use the KPC family ARO sequence from CARD database，use primers to abstract the target seq， then make a KMA database.
2. In the reads.fa, this read: repeat_align, have the repeat result 29,37,29,37
3. I have another question, the read: uniq_to_KPC_76； I think this read should also belongs to KPC-2. I used blastn checked this read. Am I right？

The KMA version I use: KMA-1.4.7

The command line is in the kma.sh file.

Thank you.

[li chen]

‌

[ptlcc]

Fixed Issue #74

→ <<cset beac9fac1771>>

[ptlcc]

Hi Li

I have looked into the issue, and indeed there was an error in the frag_raw file. This has only affected the output itself in the frag_raw file, while the remaining part of the code has been unaffected. This has been resolved in version 1.4.11.

Regarding 3., there is a nucleotide difference (C->A) between KPC-2 and -76, causing KPC-76 to get a higher score. You can include nearby matches with the “-proxi” option. Where “-proxi 0.99” will include all template matches with a score within 99% of the best match and count them as equals, “-proxi -0.99“ will do the same except the original scores will be used in the ConClave scheme.

Best,
Philip

[li chen]

Thank you. Regarding 3. , the nucleotide difference (C->A) is between reads and KPC-2, 76. There is a indel between KPC-2 and KPC-76.