Error at expression analysis using EdgeR
Issue #63
resolved
Hello,
I realized all of the analysis but the expression was failed:
[Wed Oct 26 10:48:18 2016] Starting a "bowtie1-bowtie2" Alignment Analysis [Wed Oct 26 10:53:01 2016] "bowtie1-bowtie2" Alignment Analysis finished [Wed Oct 26 10:53:01 2016] Starting a Readcount Analysis [Wed Oct 26 10:53:09 2016] Readcount Analysis finished. [Wed Oct 26 10:53:09 2016] Starting a differential expression analysis using EdgeR software(s) Problem while running this R command: print(resultsfiles)
Error: print(resultsfiles) : object 'resultsfiles' not found
Why occurs this?
Thank you in advance!!
Comments (36)
-
-
Hi, I also meet this problem this two day. But when I read the Issue 55, I just solve this problem.
The reason of your problem may be same with me. I just solve it by install the R packages.
Look at the issue 55, and there are some code to check the R package.
$>R
R version 3.2.2 (2015-08-14) -- "Fire Safety" Copyright (C) 2015 The R Foundation for Statistical Computing Platform: x86_64-apple-darwin13.4.0 (64-bit)Inside R:
> source("http://valkyrie.us.es/CbBio/RNASeq/R-Scripts/QC_EdgeR.R")######################################################################### QC_EdgeR R function Created at Computational Biology and Bioinformatics Group (CbBio) Institute of Biomedicine of Seville. IBIS (Spain) Copyright (c) 2016 IBIS. All rights reserved. mail : miarmaseq-devel@cbbio.es ######################################################################### Get help typing QC_EdgeR_help()Then:
> list.of.packages <- c("ggplot2", "Rcpp","edgeR","NOISeq","gplots","lattice","genefilter","RColorBrewer") > lapply(list.of.packages, require, character.only = TRUE) Loading required package: ggplot2 Need help? Try the ggplot2 mailing list: http://groups.google.com/group/ggplot2. Loading required package: Rcpp Loading required package: edgeR Loading required package: limma Loading required package: NOISeq Loading required package: Biobase Loading required package: BiocGenerics Loading required package: parallel Attaching package: ‘BiocGenerics’ The following objects are masked from ‘package:parallel’: clusterApply, clusterApplyLB, clusterCall, clusterEvalQ, clusterExport, clusterMap, parApply, parCapply, parLapply, parLapplyLB, parRapply, parSapply, parSapplyLB The following object is masked from ‘package:limma’: plotMA The following objects are masked from ‘package:stats’: IQR, mad, xtabs The following objects are masked from ‘package:base’: Filter, Find, Map, Position, Reduce, anyDuplicated, append, as.data.frame, as.vector, cbind, colnames, do.call, duplicated, eval, evalq, get, grep, grepl, intersect, is.unsorted, lapply, lengths, mapply, match, mget, order, paste, pmax, pmax.int, pmin, pmin.int, rank, rbind, rownames, sapply, setdiff, sort, table, tapply, union, unique, unlist, unsplit Welcome to Bioconductor Vignettes contain introductory material; view with 'browseVignettes()'. To cite Bioconductor, see 'citation("Biobase")', and for packages 'citation("pkgname")'. Loading required package: splines Loading required package: Matrix Attaching package: ‘NOISeq’ The following object is masked from ‘package:edgeR’: rpkm Loading required package: gplots Attaching package: ‘gplots’ The following object is masked from ‘package:stats’: lowess Loading required package: lattice Loading required package: genefilter Attaching package: ‘genefilter’ The following object is masked from ‘package:base’: anyNA Loading required package: RColorBrewerFinally:
> sessionInfo() R version 3.2.2 (2015-08-14) Platform: x86_64-apple-darwin13.4.0 (64-bit) Running under: OS X 10.11.6 (El Capitan) locale: [1] C/UTF-8/C/C/C/C attached base packages: [1] splines parallel stats graphics grDevices utils datasets [8] methods base other attached packages: [1] RColorBrewer_1.1-2 genefilter_1.52.0 lattice_0.20-33 [4] gplots_2.17.0 NOISeq_2.14.0 Matrix_1.2-3 [7] Biobase_2.30.0 BiocGenerics_0.16.1 edgeR_3.12.0 [10] limma_3.26.3 Rcpp_0.12.2 ggplot2_1.0.1 loaded via a namespace (and not attached): [1] AnnotationDbi_1.32.2 magrittr_1.5 IRanges_2.4.5 [4] MASS_7.3-45 munsell_0.4.2 xtable_1.8-0 [7] colorspace_1.2-6 stringr_1.0.0 plyr_1.8.3 [10] caTools_1.17.1 tools_3.2.2 grid_3.2.2 [13] gtable_0.1.2 KernSmooth_2.23-15 DBI_0.3.1 [16] gtools_3.5.0 survival_2.38-3 digest_0.6.8 [19] reshape2_1.4.1 S4Vectors_0.8.4 bitops_1.0-6 [22] RSQLite_1.0.0 gdata_2.17.0 stringi_1.0-1 [25] scales_0.3.0 stats4_3.2.2 XML_3.98-1.3 [28] annotate_1.48.0 proto_0.3-10just install those R packages and run the example again.
- ggplot2
- Rcpp
- edgeR
- NOISeq
- gplots
- lattice
- genefilter
- RColorBrewer
Holp to help you.
-
Ryu Zheng, thank you very much ! In fact the problem was similar to that. I't is important to use the "personal library" option when installing Bioconductor". In such a way, you will be able to install all R packages successfully.
Regards!
-
- changed status to resolved
Problem solved by reinstalling Bioconductor
-
Dear all,
First, thanks for this great tool. I am totally new in coding, so please be patient with me. I have the same error, I followed the post, still the same error. I guess, it is because of my R version and the version of the packages. Can you confirm? Can you tell me how to fix this?
So on R, when I followed the post
source("https://bioconductor.org/biocLite.R") Bioconductor version 3.5 (BiocInstaller 1.26.0), ?biocLite for help > list.of.packages<- c("ggplot2", "Rcpp", "edgeR", "NOISeq", "gplots", "lattice", "genefilter", "RColorBrewer") > biocLite(list.of.packages) BioC_mirror: https://bioconductor.org Using Bioconductor 3.5 (BiocInstaller 1.26.0), R 3.4.0 (2017-04-21). Installing package(s) ‘ggplot2’, ‘Rcpp’, ‘edgeR’, ‘NOISeq’, ‘gplots’, ‘lattice’, ‘genefilter’, ‘RColorBrewer’ trying URL 'https://rweb.crmda.ku.edu/cran/bin/macosx/el-capitan/contrib/3.4/ggplot2_2.2.1.tgz' Content type 'application/x-gzip' length 2792414 bytes (2.7 MB) ================================================== downloaded 2.7 MB trying URL 'https://rweb.crmda.ku.edu/cran/bin/macosx/el-capitan/contrib/3.4/Rcpp_0.12.10.tgz' Content type 'application/x-gzip' length 3275464 bytes (3.1 MB) ================================================== downloaded 3.1 MB trying URL 'https://bioconductor.org/packages/3.5/bioc/bin/macosx/el-capitan/contrib/3.4/edgeR_3.18.0.tgz' Content type 'application/x-gzip' length 1717399 bytes (1.6 MB) ================================================== downloaded 1.6 MB trying URL 'https://bioconductor.org/packages/3.5/bioc/bin/macosx/el-capitan/contrib/3.4/NOISeq_2.20.0.tgz' Content type 'application/x-gzip' length 1588434 bytes (1.5 MB) ================================================== downloaded 1.5 MB trying URL 'https://rweb.crmda.ku.edu/cran/bin/macosx/el-capitan/contrib/3.4/gplots_3.0.1.tgz' Content type 'application/x-gzip' length 511191 bytes (499 KB) ================================================== downloaded 499 KB trying URL 'https://rweb.crmda.ku.edu/cran/bin/macosx/el-capitan/contrib/3.4/lattice_0.20-35.tgz' Content type 'application/x-gzip' length 721744 bytes (704 KB) ================================================== downloaded 704 KB trying URL 'https://bioconductor.org/packages/3.5/bioc/bin/macosx/el-capitan/contrib/3.4/genefilter_1.58.0.tgz' Content type 'application/x-gzip' length 1972682 bytes (1.9 MB) ================================================== downloaded 1.9 MB trying URL 'https://rweb.crmda.ku.edu/cran/bin/macosx/el-capitan/contrib/3.4/RColorBrewer_1.1-2.tgz' Content type 'application/x-gzip' length 24322 bytes (23 KB) ================================================== downloaded 23 KB The downloaded binary packages are in /var/folders/cj/vgyg0g1s3sv799wsl1_v4gjw0000gn/T//Rtmp3xPjpx/downloaded_packagesAnd then,
sessionInfo() R version 3.4.0 (2017-04-21) Platform: x86_64-apple-darwin15.6.0 (64-bit) Running under: OS X El Capitan 10.11.6 Matrix products: default BLAS: /Library/Frameworks/R.framework/Versions/3.4/Resources/lib/libRblas.0.dylib LAPACK: /Library/Frameworks/R.framework/Versions/3.4/Resources/lib/libRlapack.dylib locale: [1] en_US.UTF-8/en_US.UTF-8/en_US.UTF-8/C/en_US.UTF-8/en_US.UTF-8 attached base packages: [1] splines parallel stats graphics grDevices utils datasets [8] methods base other attached packages: [1] BiocInstaller_1.26.0 RColorBrewer_1.1-2 genefilter_1.58.0 [4] lattice_0.20-35 gplots_3.0.1 NOISeq_2.20.0 [7] Matrix_1.2-10 Biobase_2.36.0 BiocGenerics_0.22.0 [10] edgeR_3.18.0 limma_3.32.1 Rcpp_0.12.10 [13] ggplot2_2.2.1 loaded via a namespace (and not attached): [1] compiler_3.4.0 plyr_1.8.4 bitops_1.0-6 [4] tools_3.4.0 digest_0.6.12 annotate_1.54.0 [7] RSQLite_1.1-2 memoise_1.1.0 tibble_1.3.0 [10] gtable_0.2.0 DBI_0.6-1 S4Vectors_0.14.0 [13] gtools_3.5.0 caTools_1.17.1 IRanges_2.10.0 [16] locfit_1.5-9.1 stats4_3.4.0 grid_3.4.0 [19] AnnotationDbi_1.38.0 XML_3.98-1.6 survival_2.41-3 [22] gdata_2.17.0 scales_0.4.1 colorspace_1.3-2 [25] xtable_1.8-2 KernSmooth_2.23-15 RCurl_1.95-4.8 [28] lazyeval_0.2.0 munsell_0.4.3With these settings, I still have the same error
######################################################################### # miARma, miRNA and RNASeq Multiprocess Analysis # # miARma v 1.5 (Apr-2016) # # # # Created at Computational Biology and Bioinformatics Group (CbBio) # # Institute of Biomedicine of Seville. IBIS (Spain) # # Copyright (c) 2016 IBIS. All rights reserved. # # mail : miARma-devel@cbbio.es # ######################################################################### [Tue May 2 20:37:11 2017] Starting a miARma analysis for miRNA [Tue May 2 20:37:11 2017] Checking provided parameters for: Quality,Adapter,Aligner,ReadCount,DEAnalysis,TargetPrediction. [Tue May 2 20:37:11 2017] Checking General-output_dir parameter ... Exists! [Tue May 2 20:37:11 2017] The folder specified in (output_dir=Examples/basic_examples/miRNAs/Known_miRNAs/results) already exists. [Tue May 2 20:37:11 2017] Wait 5 seconds to overwrite the folder. Cancel otherwise: 0 [Tue May 2 20:37:17 2017] Continue. [Tue May 2 20:37:17 2017] All parameters are correct. [Tue May 2 20:37:17 2017] Starting Quality Analysis. [Tue May 2 20:37:39 2017] Quality Analysis finished. [Tue May 2 20:37:39 2017] Checking if files in folder: "Examples/basic_examples/miRNAs/reads" are in the correct fastq format. [Tue May 2 20:37:39 2017] Starting a Adapter removal analysis [Tue May 2 20:38:03 2017] Adapter Analysis finished. [Tue May 2 20:38:03 2017] Starting a Post Quality Analysis [Tue May 2 20:38:21 2017] Post Quality Analysis finished. [Tue May 2 20:38:21 2017] Starting a "Bowtie1" Alignment Analysis [Tue May 2 20:42:46 2017] "Bowtie1" Alignment Analysis finished [Tue May 2 20:42:46 2017] Starting a Readcount Analysis [Tue May 2 20:42:49 2017] Readcount Analysis finished. [Tue May 2 20:42:49 2017] Starting a differential expression analysis using EdgeR software(s) Problem while running this R command: print(resultsfiles) Error: print(resultsfiles) : object 'resultsfiles' not found Execution haltedThanks a lot for your help
Regards Celia
-
Dear Celia, Don't worry, we will solve your problem for sure.
In order to help you I need you to answer some questions:
a) How did you install miARma ? (I see that you are using the version 1.5 but the latest is 1.6.1). As you are using a Mac (as I do), I suggest you to use the latest version installed from source. More info at http://miarmaseq.cbbio.es/installation b) Could you send me your log files? (inside Examples/basic_examples/miRNAs/Known_miRNAs/results you will find miARma_log and miARma_stat files) c) which perl version are you using?
Thats all.
In the meantime I'll try to execute the example using R 3.4 (miARma has been tested under R3.2 and R3.3), just in case
-
Dear Eduardo, Thanks for your answer. My guess is that I have several issues. Anyway, to answer your questions 1- miARma installation: I have followed the instruction in http://miarmaseq.cbbio.es/installation. I install it long time ago. I don't know if there is a way to upgrade it, is it? 2- log files. I found a lot... tell me which one do you want
[miARma@937cdd612273 miARma]$ ls Examples/basic_examples/miRNAs/Known_miRNAs/results -lh total 536K drwxrwxr-x 2 miARma miARma 4.0K Apr 27 12:52 Bowtie1_results drwxrwxr-x 2 miARma miARma 4.0K Apr 27 12:52 Post_fastqc_results drwxrwxr-x 2 miARma miARma 4.0K Apr 27 12:52 Pre_fastqc_results drwxrwxr-x 2 miARma miARma 4.0K Apr 25 14:54 Readcount_results drwxrwxr-x 2 miARma miARma 4.0K Apr 27 12:57 cut_bw1_readcount_results drwxrwxr-x 2 miARma miARma 4.0K Apr 27 12:52 cutadapt_results -rw-rw-r-- 1 miARma miARma 1.3K Apr 24 21:31 miARma_logfile.124.log -rw-rw-r-- 1 miARma miARma 14K Apr 25 15:05 miARma_logfile.183.log -rw-rw-r-- 1 miARma miARma 14K Apr 25 16:29 miARma_logfile.3214.log -rw-rw-r-- 1 miARma miARma 0 Apr 25 17:25 miARma_logfile.3331.log -rw-rw-r-- 1 miARma miARma 14K Apr 25 16:56 miARma_logfile.3353.log -rw-rw-r-- 1 miARma miARma 0 Apr 25 17:25 miARma_logfile.3470.log -rw-rw-r-- 1 miARma miARma 14K Apr 25 17:28 miARma_logfile.3482.log -rw-rw-r-- 1 miARma miARma 4.9K May 4 14:12 miARma_logfile.3602.log -rw-rw-r-- 1 miARma miARma 589 Apr 25 17:52 miARma_logfile.3615.log -rw-rw-r-- 1 miARma miARma 577 Apr 25 17:53 miARma_logfile.3628.log -rw-rw-r-- 1 miARma miARma 7.8K Apr 25 17:53 miARma_logfile.3641.log -rw-rw-r-- 1 miARma miARma 14K Apr 26 19:08 miARma_logfile.3775.log -rw-rw-r-- 1 miARma miARma 14K Apr 27 12:51 miARma_logfile.3893.log -rw-rw-r-- 1 miARma miARma 22K Apr 27 12:57 miARma_logfile.4015.log -rw-rw-r-- 1 miARma miARma 22K Apr 27 14:49 miARma_logfile.4201.log -rw-rw-r-- 1 miARma miARma 22K Apr 27 16:48 miARma_logfile.4387.log -rw-rw-r-- 1 miARma miARma 22K Apr 28 15:17 miARma_logfile.4573.log -rw-rw-r-- 1 miARma miARma 22K Apr 28 18:54 miARma_logfile.4759.log -rw-rw-r-- 1 miARma miARma 22K May 1 12:13 miARma_logfile.4945.log -rw-rw-r-- 1 miARma miARma 22K May 1 14:49 miARma_logfile.5131.log -rw-rw-r-- 1 miARma miARma 22K May 2 16:14 miARma_logfile.5317.log -rw-rw-r-- 1 miARma miARma 3.2K May 2 20:05 miARma_logfile.5503.log -rw-rw-r-- 1 miARma miARma 22K May 2 20:35 miARma_logfile.5559.log -rw-rw-r-- 1 miARma miARma 22K May 2 20:42 miARma_logfile.5745.log -rw-rw-r-- 1 miARma miARma 52 Apr 24 21:31 miARma_stat.124.log -rw-rw-r-- 1 miARma miARma 2.8K Apr 25 14:54 miARma_stat.183.log -rw-rw-r-- 1 miARma miARma 2.8K Apr 25 16:29 miARma_stat.3214.log -rw-rw-r-- 1 miARma miARma 0 Apr 25 17:25 miARma_stat.3331.log -rw-rw-r-- 1 miARma miARma 2.8K Apr 25 16:56 miARma_stat.3353.log -rw-rw-r-- 1 miARma miARma 0 Apr 25 17:25 miARma_stat.3470.log -rw-rw-r-- 1 miARma miARma 2.8K Apr 25 17:28 miARma_stat.3482.log -rw-rw-r-- 1 miARma miARma 0 May 4 14:12 miARma_stat.3602.log -rw-rw-r-- 1 miARma miARma 0 Apr 25 17:52 miARma_stat.3615.log -rw-rw-r-- 1 miARma miARma 0 Apr 25 17:53 miARma_stat.3628.log -rw-rw-r-- 1 miARma miARma 0 Apr 25 17:53 miARma_stat.3641.log -rw-rw-r-- 1 miARma miARma 2.8K Apr 26 19:08 miARma_stat.3775.log -rw-rw-r-- 1 miARma miARma 2.8K Apr 27 12:51 miARma_stat.3893.log -rw-rw-r-- 1 miARma miARma 5.3K Apr 27 12:57 miARma_stat.4015.log -rw-rw-r-- 1 miARma miARma 5.3K Apr 27 14:49 miARma_stat.4201.log -rw-rw-r-- 1 miARma miARma 5.3K Apr 27 16:48 miARma_stat.4387.log -rw-rw-r-- 1 miARma miARma 5.3K Apr 28 15:17 miARma_stat.4573.log -rw-rw-r-- 1 miARma miARma 5.3K Apr 28 18:54 miARma_stat.4759.log -rw-rw-r-- 1 miARma miARma 5.3K May 1 12:13 miARma_stat.4945.log -rw-rw-r-- 1 miARma miARma 5.3K May 1 14:49 miARma_stat.5131.log -rw-rw-r-- 1 miARma miARma 5.3K May 2 16:14 miARma_stat.5317.log -rw-rw-r-- 1 miARma miARma 2.3K May 2 20:05 miARma_stat.5503.log -rw-rw-r-- 1 miARma miARma 5.3K May 2 20:35 miARma_stat.5559.log -rw-rw-r-- 1 miARma miARma 5.3K May 2 20:42 miARma_stat.5745.log drwxrwxr-x 2 miARma miARma 4.0K Apr 25 16:50 miRGate_results -rw-rw-r-- 1 miARma miARma 24K May 2 20:42 summary_results_A_million_PBMC_miARma.xls -rw-rw-r-- 1 miARma miARma 317 Apr 25 17:53 summary_results_Hypoxia_miARma.xls3- Perl version: This is perl 5, version 18, subversion 2 (v5.18.2) built for darwin-thread-multi-2level
Let me know if you need something else Thanks Celia
-
Hi,
I have created another container with a new analysis. This time, I had just one log file
Examples/basic_examples/miRNAs/Known_miRNAs/results/miARma_logfile.118.log || Input files : 1 SAM file || || S Examples/basic_examples/miRNAs/Known_miRNA ... || || || || Output file : Examples/basic_examples/miRNAs/Known_miRNAs/ ... || || Annotations : Examples/basic_examples/miRNAs/data/miRBase_ ... || || || || Threads : 4 || || Level : meta-feature level || || Paired-end : no || || Strand specific : yes || || Multimapping reads : not counted || || Multi-overlapping reads : not counted || || Read orientations : fr || || || \\===================== http://subread.sourceforge.net/ ======================// //================================= Running ==================================\\ || || || Load annotation file Examples/basic_examples/miRNAs/data/miRBase_Annot ... || || Features : 2794 || || Meta-features : 2576 || || Chromosomes/contigs : 24 || || || || Process SAM file Examples/basic_examples/miRNAs/Known_miRNAs/results/B ... || || Single-end reads are included. || || Assign reads to features... || || Total reads : 246235 || || Successfully assigned reads : 7790 (3.2%) || || Running time : 0.01 minutes || || || || Read assignment finished. || || || \\===================== http://subread.sourceforge.net/ ======================// SEQCOUNT :: [Thu May 4 17:42:09 2017] Please check the folder: Examples/basic_examples/miRNAs/Known_miRNAs/results/Readcount_results/. QC_EdgeR :: [Thu May 4 17:42:10 2017] Executing setwd("/home/miARma/miARma/Examples/basic_examples/miRNAs/Known_miRNAs/results/Readcount_results") source("http://valkyrie.us.es/CbBio/RNASeq/R-Scripts/QC_EdgeR.R") resultsfiles<-QC_EdgeR(projectdir="/home/miARma/miARma/Examples/basic_examples/miRNAs/Known_miRNAs/results",dir="/home/miARma/miARma/Examples/basic_examples/miRNAs/Known_miRNAs/results/Readcount_results", file="cut_bw1-ReadCount.tab", targetfile="/home/miARma/miARma/Examples/basic_examples/miRNAs/data/targets.txt", label="Hypoxia_cut_bw1", filter="yes")and another file stat.log
Examples/basic_examples/miRNAs/Known_miRNAs/results/miARma_stat.118.log 19 488 0.0 1 475 13 20 346 0.0 2 326 20 21 359 0.0 2 346 13 22 528 0.0 2 498 30 23 540 0.0 2 520 18 2 24 194 0.0 2 189 5 25 257 0.0 2 247 10 26 1227 0.0 2 1172 53 2 27 2404 0.0 2 2280 120 4 28 3544 0.0 2 3398 135 11 29 1176 0.0 2 1116 55 5 30 554 0.0 2 541 11 2 31 387 0.0 2 376 11 32 353 0.0 2 342 11 33 546 0.0 2 534 12 34 535 0.0 2 520 14 1 35 744 0.0 2 729 15 36 540 0.0 2 533 7 37 371 0.0 2 358 10 3 38 236 0.0 2 227 9 39 393 0.0 2 389 4 40 227 0.0 2 218 8 1 41 237 0.0 2 233 4 42 443 0.0 2 437 3 3 43 356 0.0 2 350 6 44 249 0.0 2 245 3 1 45 156 0.0 2 153 3 46 180 0.0 2 180 47 49 0.0 2 48 1 48 99 0.0 2 96 3 49 113 0.0 2 106 7 FASTQCSTATS :: [Thu May 4 17:39:41 2017] Name miRNA_clean_cut_fastqc Total Sequences: 246235 Sequence length: 15-35 Encoding: Sanger / Illumina 1.9 GCcontent: 45% BOWTIE1 :: File:Examples/basic_examples/miRNAs/Known_miRNAs/results/cutadapt_results/miRNA_clean_cut.fastq # reads processed: 246235 # reads with at least one reported alignment: 16823 (6.83%) # reads that failed to align: 229412 (93.17%) Reported 16823 alignments to 1 output stream(s)Hope it's what you needed
Thanks Celia
-
Hi, we will start by the easier thing. Could you enter into your folder: /home/miARma/miARma/ ?
Then execute R, and inside the R shell, please type the following:
setwd("/home/miARma/miARma/Examples/basic_examples/miRNAs/Known_miRNAs/results/Readcount_results") source("http://valkyrie.us.es/CbBio/RNASeq/R-Scripts/QC_EdgeR.R") QC_EdgeR(projectdir="/home/miARma/miARma/Examples/basic_examples/miRNAs/Known_miRNAs/results",dir="/home/miARma/miARma/Examples/basic_examples/miRNAs/Known_miRNAs/results/Readcount_results", file="cut_bw1-ReadCount.tab", targetfile="/home/miARma/miARma/Examples/basic_examples/miRNAs/data/targets.txt", label="Hypoxia_cut_bw1", filter="yes")Regarding you second question, to install a new version, you need to perform a new installation. If you want to have a version that can be update it, you need the git version of miARma. But I recommend you to install the new version from the source. (The examples, reads and genome are always the same, so you only need to download once).
Let me know what error appears in the R shell
Eduardo
-
Hi,
This is the error
QC_EdgeR(projectdir="/home/miARma/miARma/Examples/basic_examples/miRNAs/Known_miRNAs/results",dir="/home/miARma/miARma/Examples/basic_examples/miRNAs/Known_miRNAs/results/Readcount_results", file="cut_bw1-ReadCount.tab", targetfile="/home/miARma/miARma/Examples/basic_examples/miRNAs/data/targets.txt", label="Hypoxia_cut_bw1", filter="yes") Loading required package: edgeR Loading required package: limma Loading required package: ggplot2 Loading required package: gplots Attaching package: 'gplots' The following object is masked from 'package:stats': lowess Loading required package: genefilter Attaching package: 'genefilter' The following object is masked from 'package:base': anyNA 2017-05-05 12:55:02 Starting quality control analysis of Hypoxia_cut_bw1 Error in DGEList(counts = data, group = group) : Length of 'group' must equal number of columns in 'counts'For the second question, how do I git miARma?
Celia
-
Hi, Do you need something else to solve this issue? Any news for R version 3.4? Thanks a lot for your help
-
Hi Celia, In you above example, did you use miArma 1.5 or 1.6.1 ? The error you are showing tells you that your result files are in a wrong format o they are missing. And this is not related with R versions Regarding the git, I sent you an email a week ago but it seems that it got lost:
-
Hi, Sorry, I didn't receive the email. I am not able to git miARma. This is my error
Cloning into 'miarma'... Permission denied (publickey). fatal: Could not read from remote repository.
Please make sure you have the correct access rights and the repository exists.
-
Ummmm bitbucket is changing too much things regarding the security. Anyone is granted to download the whole repository .... but I don't known under which terms
Could you try with: git clone https://your_bitbucket_username@bitbucket.org/cbbio/miarma.git
Regarding R3.4, I haven't found any problem running all (4) examples.
Edu
-
Hi,
After using the command rm to remove miARma, I was able to run the command git clone.
I reinstalled everything but it's still the version 1.5, don't understand why.
I ran the program with the Examples, it worked but when I ran the program with my sample, it didn't word, still the same error
######################################################################### # miARma, miRNA and RNASeq Multiprocess Analysis # # miARma v 1.5 (Apr-2016) # # # # Created at Computational Biology and Bioinformatics Group (CbBio) # # Institute of Biomedicine of Seville. IBIS (Spain) # # Copyright (c) 2016 IBIS. All rights reserved. # # mail : miARma-devel@cbbio.es # ######################################################################### [Fri May 26 12:27:37 2017] Starting a miARma analysis for miRNA [Fri May 26 12:27:37 2017] Checking provided parameters for: Quality,Adapter,Aligner,ReadCount,DEAnalysis,TargetPrediction. [Fri May 26 12:27:37 2017] All parameters are correct. [Fri May 26 12:27:37 2017] Starting Quality Analysis. [Fri May 26 12:27:48 2017] Quality Analysis finished. [Fri May 26 12:27:48 2017] Checking if files in folder: "Examples/basic_examples/miRNAs/reads/" are in the correct fastq format. [Fri May 26 12:27:48 2017] Starting a Adapter removal analysis [Fri May 26 12:27:59 2017] Adapter Analysis finished. [Fri May 26 12:27:59 2017] Starting a Post Quality Analysis [Fri May 26 12:28:08 2017] Post Quality Analysis finished. [Fri May 26 12:28:08 2017] Starting a "Bowtie1" Alignment Analysis [Fri May 26 12:30:35 2017] "Bowtie1" Alignment Analysis finished [Fri May 26 12:30:35 2017] Starting a Readcount Analysis [Fri May 26 12:30:36 2017] Readcount Analysis finished. [Fri May 26 12:30:36 2017] Starting a differential expression analysis using EdgeR software(s) Problem while running this R command: print(resultsfiles) Error: print(resultsfiles) : object 'resultsfiles' not found Execution haltedAny ideas?
Thanks
Celia
-
This has no sense. The version 1.6.1 is the only one available since February The version 1.5 uses a server for the differential expression module that is not available
-
Maybe everything was not well removed?
How would you do to rm everything from the computer to start from scratch?
-
I guess so.
I recommend you to follow the steps explained in the web page for a Linux - Source installation: http://miarmaseq.cbbio.es/installation
That is: First, check pre-requisites:
Perl v5.16.0 or higher. (By default in almost any linux computer). http://www.cpan.org/src/5.0/perl-5.16.1.tar.gz Basic compiling software (By default in almost any linux computer) Gcc: https://ftp.gnu.org/gnu/gcc/ make: http://ftp.gnu.org/gnu/make/ R environment v.3.2.x or higher. (Needed for differential expression & Enrichment) http://www.r-project.org/ Bioconductor v.1.3 or higher. (Needed for differential expression & Enrichment) http://www.bioconductor.org/install/ Java JDK v.1.6. or higher.(For Quality Analysis) http://www.java.com/Then, install miARma-seq:
mkdir NGS cd NGS/ NGS> curl -L -O https://bitbucket.org/cbbio/miarma/get/master.tar.bz2 NGS> tar -xjf master.tar.bz2 NGS>cd cbbio-miarma-* cbbio-miarma>ls -l Examples README.md bin lib miARma cbbio-miarma>./miARmaNow you have to see the version 1.6.1
Then, move to the example web page: http://miarmaseq.cbbio.es/examples
-
Hi Eduardo,
This is my configuration
perl 5, version 18, subversion 2 Gcc --version Configured with: --prefix=/Applications/Xcode.app/Contents/Developer/usr --with-gxx-include-dir=/usr/include/c++/4.2.1 Apple LLVM version 7.0.0 (clang-700.0.72) Target: x86_64-apple-darwin15.6.0 Thread model: posix GNU Make 3.81 R version 3.4.0 (2017-04-21) BioC_mirror: https://bioconductor.org Using Bioconductor 3.5 (BiocInstaller 1.26.0), R 3.4.0 (2017-04-21) Java 8 Update 131.I was able to install the new version, but I still have the same issue
######################################################################### # miARma, miRNA and RNASeq Multiprocess Analysis # # miARma v 1.6.1 (Feb-2017) # # # # Created at Computational Biology and Bioinformatics Group (CbBio) # # Institute of Biomedicine of Seville. IBIS (Spain) # # Copyright (c) 2017 IBIS. All rights reserved. # # mail : miARma-devel@cbbio.es # ######################################################################### [Thu Jun 1 11:51:02 2017] Starting a miARma analysis for miRNA [Thu Jun 1 11:51:02 2017] Checking provided parameters for: Quality,Adapter,Aligner,ReadCount,DEAnalysis,TargetPrediction. [Thu Jun 1 11:51:02 2017] All parameters are correct. [Thu Jun 1 11:51:02 2017] Starting Quality Analysis. [Thu Jun 1 11:51:20 2017] Quality Analysis finished. [Thu Jun 1 11:51:20 2017] Checking if files in folder: "Examples/basic_examples/miRNAs/reads/" are in the correct fastq format. [Thu Jun 1 11:51:20 2017] Starting a Adapter removal analysis [Thu Jun 1 11:51:44 2017] Adapter Analysis finished. [Thu Jun 1 11:51:44 2017] Starting a Post Quality Analysis [Thu Jun 1 11:52:00 2017] Post Quality Analysis finished. [Thu Jun 1 11:52:00 2017] Starting a "Bowtie1" Alignment Analysis [Thu Jun 1 11:56:07 2017] "Bowtie1" Alignment Analysis finished [Thu Jun 1 11:56:07 2017] Starting a Readcount Analysis [Thu Jun 1 11:56:09 2017] Readcount Analysis finished. [Thu Jun 1 11:56:09 2017] Starting a differential expression analysis using EdgeR software(s) Problem while running this R command: print(resultsfiles) Error: print(resultsfiles) : object 'resultsfiles' not found Execution haltedI didn't run the example files. What can I do now?
Thanks
Celia
-
Fine !!! Now everything will be easier
When you installed bioconductor, did you install it using a personal library ? This is mandatory. Anyway, you can do the following:
1) Execute R in your terminal 2) R> source("http://bioconductor.org/biocLite.R") #(if this asks for a personal library, please choose yes) 3) R> biocLite(c("ggplot2", "Rcpp","edgeR","NOISeq","gplots","lattice","genefilter","RColorBrewer"))Once this packages are installed, miARma has all packages to perform the differential expression analysis
Please let me know
-
Exactly the same error...
-
ummmm please send me your logs files (miARma_log.xxx and miaRma_stats.xxx)
-
Hi, This is the link to download the complete "results" file: https://we.tl/XKBCcbG8Nq Looks like there is no stats file... Let me know if you can not download the file Thanks a lot for your help
-
Everything seems ok, so it must be related with R and bioconductor
So please try now this:
1) Enter in /home/miARma/NGS/cbbio-miarma-5e3a903c0c3c/ and then execute R 2) R> source("./lib/CbBio/RNASeq/R-Scripts/QC_EdgeR.R") 3) R> setwd("/home/miARma/NGS/cbbio-miarma-5e3a903c0c3c/Examples/basic_examples/miRNAs/Known_miRNAs/results/Readcount_results") 4) R> QC_EdgeR(projectdir="/home/miARma/NGS/cbbio-miarma-5e3a903c0c3c/Examples/basic_examples/miRNAs/Known_miRNAs/results",dir="/home/miARma/NGS/cbbio-miarma-5e3a903c0c3c/Examples/basic_examples/miRNAs/Known_miRNAs/results/Readcount_results", file="cut_bw1-ReadCount.tab", targetfile="/home/miARma/NGS/cbbio-miarma-5e3a903c0c3c/Examples/basic_examples/miRNAs/data/targets.txt", label="Hypoxia_cut_bw1", filter="yes")Let me known what error did you see
-
I see
Error in DGEList(counts = data, group = group) :
Length of 'group' must equal number of columns in 'counts'
-
OMG ! You are not using the examples !!!!!
If your are using your own fastq files, did you also modify the targets,txt and the contrast.txt ? I guess that your are combining your experiment (2 samples) with miARma examples (6 samples)
Am I right ?
-
Yes you are! I didn't check those targets and contrast. txt files What do I have to do? I can see on your guide
-
That's why it previously worked with the examples but not my samples... Sorry for that, as I said, I am a total beginner...
-
Filename Name Time miRNA_clean PBMC_1M T0h miRNA_clean2 Duplicate T0h
-
But in this target fiel I see only one group (T0h). Where is the other group to compare with ?
Edu
-
Right now I have 1 sample to analyse. At term I will have 72 (waiting for the sequencing). Can I make some "fake"? For the 72 samples, I wonder, what happens if they have different adapters?
-
Hi, You can create 72 fastq files using ArtificialFastqGenerator or XS. Although they won't have nothing in common and there won't be any differential expressed miRNA. You can also use our provided reads in the example and copy them with different names. But the important thing here is not the number of samples, but the groups. Hoy many different groups did you expect?
Regarding your second question, although is rare to have different adapters, you can check the example 2.6 to define different adapter sequences :
Examples/basic_examples/miRNAs/Known_miRNAs/2.Adapter/2.6.Cutadapt_multiplexed_adapter_removal.ini
-
Filename Adapter miRNA_clean.fastq TGGAATTCTCGGGTGCCAAGG miRNA_clean2.fastq TGGAATTCTCGGGTGCCAAGG miRNA_clean3.fastq TGGAATTCTCGGGTGCCAAGG miRNA_clean4.fastq TGGAATTCTCGGGTGCCAAGG miRNA_clean5.fastq TGGAATTCTCGGGTGCCAAGG miRNA_clean6.fastq TGGAATTCTCGGGTGCCAAGG miRNA_clean7.fastq TGGAATTCTCGGGTGCCAAGG miRNA_clean8.fastq TGGAATTCTCGGGTGCCAAGG
-
Hi Celia, is that a question for me ?
-
Hi Eduardo, I have my 72 samples now. Ran a analysis and still the same error appeared. I was able to see the number of read per microRNA. My PI is excited with those results. He proposed me to meet you to solve this issue and learn more about the program. I will be in Paris ~June 22nd to June 30th. If you are available you could come in Paris or I can come to your lab, it's up to you. My PI is OK to pay for the trip. Let me know what do you think Celia
-
Hi Celia, could you send me an email to eduardo.andres@csic.es ?
Thanks
- Log in to comment
Hi Santi, I'll need more information to help you. Is this a miRNA experiment ? mRNA ? Why don't you send me the ini file and logs to my personal email ? (Osvaldo knows it)
Regards