1. CBBIO Avatar CBBIO
  2. Untitled project
  3. miARma
  4. Issues

Cutadapt Error

Issue #122 resolved
Former user created an issue

Hello

I run miRNA-Known miRNA-Basic examples on miARma version 1.7 but I get this error:

anybody can help me, please? CUTADAPT ERROR :: system args failed: 256 (mkdir -p Examples/basic_examples/miRNAs/Known_miRNAs/results///cutadapt_results/ ; cut_adapt -b ATCTCGTATGCCGTCTTCTGCTTGAA -m 15 -M 35 -q 0 Examples/basic_examples/miRNAs/reads///SRR873382.fastq.gz > Examples/basic_examples/miRNAs/Known_miRNAs/results///cutadapt_results/SRR873382_cut.fastq 2>> Examples/basic_examples/miRNAs/Known_miRNAs/results//miARma_stat.2498.log) at lib/CbBio/RNASeq/Adapt.pm line 854.

Comments (153)

  1. Eduardo Andres Leon

    Hi, could you send me your log files ? (miARma_log and miARma_stats)

    did you have another cutadapt version installed ?

    E

  4. Eduardo Andres Leon

    As I see ,your error is:

    Traceback (most recent call last): File "./bin/Linux/cutadapt//cut_adapt", line 9, in <module> from cutadapt.scripts import cutadapt File "/home/leila/apps/miARma/cbbio-miarma-42e187a7f514/bin/Linux/cutadapt/cutadapt/scripts/cutadapt.py", line 74, in <module> from cutadapt.adapters import Adapter, ColorspaceAdapter, BACK, FRONT, PREFIX, ANYWHERE File "/home/leila/apps/miARma/cbbio-miarma-42e187a7f514/bin/Linux/cutadapt/cutadapt/adapters.py", line 4, in <module> from cutadapt import align, colorspace File "/home/leila/apps/miARma/cbbio-miarma-42e187a7f514/bin/Linux/cutadapt/cutadapt/align.py", line 225, in <module> from cutadapt.calign import globalalign_locate ImportError: /home/leila/apps/miARma/cbbio-miarma-42e187a7f514/bin/Linux/cutadapt/cutadapt/calign.so: undefined symbol: PyString_Type

    Did you have python 2.7 installed ?

    E

  7. Leila Kianmehr

    yes, thanks a lot. I have fixed this error with install ing python 2.7, but finally, I got the other error with R version 3.5.1

    Problem while running this R command: print(resultsfiles)

    Error: print(resultsfiles) : object 'resultsfiles' not found Execution halted

  8. Eduardo Andres Leon

    R 3.5 ???? they are going too fast ;)

    Could you send me your log files ? (miARma_stat and miARma_log?)

    thanks in advance

  12. Eduardo Andres Leon

    Yes, 90% of the errors are R-related

    In order to get the "real" error, I need you to type this commands in your terminal:

    bash$>cd /home/leila/apps/miARma/cbbio-miarma-42e187a7f514/
bash$>R
R>source("./lib/CbBio/RNASeq/R-Scripts/QC_EdgeR.R")
R>setwd("/home/leila/apps/miARma/cbbio-miarma-42e187a7f514/Examples/basic_examples/miRNAs/Known_miRNAs/results/Readcount_results")
R>QC_EdgeR(projectdir="/home/leila/apps/miARma/cbbio-miarma-42e187a7f514/Examples/basic_examples/miRNAs/Known_miRNAs/results",dir="/home/leila/apps/miARma/cbbio-miarma-42e187a7f514/Examples/basic_examples/miRNAs/Known_miRNAs/results/Readcount_results", file="cut_bw1-ReadCount.tab", targetfile="/home/leila/apps/miARma/cbbio-miarma-42e187a7f514/Examples/basic_examples/miRNAs/data/targets.txt", label="Hypoxia_cut_bw1", filter="yes")

    This will print the error.

  13. Leila Kianmehr

    Loading required package: edgeR Loading required package: limma Loading required package: ggplot2 Loading required package: gplots

    Attaching package: ‘gplots’

    The following object is masked from ‘package:stats’:

    lowess

    Loading required package: genefilter 2018-07-10 07:33:24 Starting quality control analysis of Hypoxia_cut_bw1 Error in colSums(counts) : 'x' must be numeric

  14. Eduardo Andres Leon

    ummm it seems that new R is doing nasty things.

    Could you also send me the summary_*.xls file ?

    Thanks

  16. Eduardo Andres Leon

    ummm it seems that you have 2 analysis mixed (lines 310 and 311 from the excel) in the out_dir folder. I guess that you used different ini files using the same out_dir

    Could you remove the folder Examples/basic_examples/miRNAs/Known_miRNAs/results/ and start the analysis again (using the Known_miRNa_miARma ini file) ?

    Again, thanks in advance

  20. Leila Kianmehr

    Hello, I have another question, I want to count miRNA from RNA-Seq data and reads are without Adaptor at the basis of Adaptor content of fastqc, so how should I define Adaptor part for that in ini file?

  21. Eduardo Andres Leon

    if the adapter has been already removed, you don't need to remove it again, just delete/comment the whole [Adapter] section

  22. Leila Kianmehr

    Hello, I need to ask some questions about the required files for miARma. at first, I checked the gff3 file which is the new version released on miRbase and the third column is miRNA_primary_transcript not miRNA, miARma will work with that? and for stat, log file, target, and contrast, I just make documents with these name, correct?

    thanks in advance

  23. Eduardo Andres Leon

    Hi Leila.

    If the third column is miRNA_primary_transcript , please include in the [ReadCount] section, the following:

    featuretype=miRNA_primary_transcript

    That's all

    The stat and log files can be specified or not (in that case miARma will create both log files for you). The target must include 3 columns splitted by tabs and specifying your samples. The contrast.txt is needed to specify the comparisons you want to perform.

    Find a target.txt and a contrast.txt file in this link:

    https://www.dropbox.com/s/dpdojw2bdqhfb9a/DE_examples.zip?dl=0

  24. Leila Kianmehr

    Dear Eduardo

    I get this error when running miARma on myself data: Checking Aligner-fasta parameter ... error! ERROR Please check that the parameter fasta inside section [Aligner] is correct. why?

  27. Eduardo Andres Leon

    Hi, miARma is complaining about the fasta file (/media/leila/LaCie/Data_colorado/Series 1/miARma/results/Bowtie2-Index/mm10.fa). It seems that this is not the correct path. Besides I highly recommend you not to use spaces in linux paths (such as Serie 1), most of the softwares can't deal with spaces

    E

  30. Leila Kianmehr

    these files were empty, I removed related comments in ini file and run again, but I don't have files with that name!! ))-:

    Checking Aligner-bowtie2index parameter ... error! ERROR Please check that the parameter bowtie2index inside section [Aligner] is correct.

  31. Leila Kianmehr

    I think need to mention that miARma is installed on my Linux and put the path of data and index files and other on external hard because data are big and don't have enough space for that

  32. Eduardo Andres Leon

    Hi,

    According with your last ini file:

    stats_file=/media/leila/LaCie/Data_colorado/Series1/miARma/results/miARma_stat.2498.log logfile=/media/leila/LaCie/Data_colorado/Series1/miARma/results/miARma_logfile.2498.log

    But, the problem your mentioning above is with the path of the index:

    bowtie2index=/media/leila/LaCie/Data_colorado/Series1/miARma/results/Bowtie2-Index/mm10

    It doesn't matter if they are in an external HD

  34. Leila Kianmehr

    yes, with this ini file I get this error, how should be fixed? Continue. [Fri Jul 13 11:53:36 2018] Checking Aligner-bowtie2index parameter ... error! ERROR Please check that the parameter bowtie2index inside section [Aligner] is correct. leila@leila-UX310UQK:~/apps/miARma/cbbio-miarma-42e187a7f514$

    thanks in advance for your answers

  35. Eduardo Andres Leon

    For example, open your terminal and type:

    ls -l /media/leila/LaCie/Data_colorado/Series1/miARma/results/Bowtie2-Index/mm10*

    Then, please show me the result

    E

  36. Leila Kianmehr

    ls -l /media/leila/LaCie/Data_colorado/Series1/miARma/Bowtie2-Index/mm10*

    -rw------- 1 leila leila 888464705 mai 2 2012 /media/leila/LaCie/Data_colorado/Series1/miARma/Bowtie2-Index/mm10.1.bt2

    -rw------- 1 leila leila 663195880 mai 2 2012 /media/leila/LaCie/Data_colorado/Series1/miARma/Bowtie2-Index/mm10.2.bt2

    -rw------- 1 leila leila 6119 mai 2 2012 /media/leila/LaCie/Data_colorado/Series1/miARma/Bowtie2-Index/mm10.3.bt2

    -rw------- 1 leila leila 663195875 mai 2 2012 /media/leila/LaCie/Data_colorado/Series1/miARma/Bowtie2-Index/mm10.4.bt2

    -rw------- 1 leila leila 2785490220 juil. 12 13:50 /media/leila/LaCie/Data_colorado/Series1/miARma/Bowtie2-Index/mm10.fa

    -rw------- 1 leila leila 888464705 mai 2 2012 /media/leila/LaCie/Data_colorado/Series1/miARma/Bowtie2-Index/mm10.rev.1.bt2

    -rw------- 1 leila leila 663195880 mai 2 2012 /media/leila/LaCie/Data_colorado/Series1/miARma/Bowtie2-Index/mm10.rev.2.bt2

  37. Eduardo Andres Leon

    Hi,

    if you look in detail both paths are diffrenet:

    In your ini file

    /media/leila/LaCie/Data_colorado/Series1/miARma/results/Bowtie2-Index/mm10

    The real one:

    /media/leila/LaCie/Data_colorado/Series1/miARma/Bowtie2-Index/mm10

  38. Leila Kianmehr

    yes, you are right, I am afraid.

    I got the last version of gff3 from mirbase for this analysis, now I get this error: ERROR :: You are requesting a miRNA readcount analysis, but no aligned files are found (Neither Bowtie1 nor Bowtie2)

    Mandatory parameters:

    [ReadCount] database=miRNAs_miRBase20.gft

    this means gff3 should not be used for that?

  39. Eduardo Andres Leon

    No, you have to write the whole path to the miRBase file (gtf, gff and gff3 are supported). Remember to adjust the featuretype and seqid parameters according with your gff3 file

  40. Leila Kianmehr

    for this file: seqid=Name and featuretype=miRNA_primary_transcript right? could you please guide me what should be written exactly according to this file?

  41. Eduardo Andres Leon

    That is correct if you want to quantify miRNA genes ... but I usually prefer to quantify mature miRNAs (most miRNA-mRNA target prediction tools such as miRGate/TargetScan ... works with mature names). So for this second analysis that I recommend you, you should use:

    seqid=Name featuretype=miRNA

  42. Leila Kianmehr

    I know what you mean but I want to quantify miRNA genes not mature and I am getting this error yet: ERROR :: You are requesting a miRNA readcount analysis, but no aligned files are found (Neither Bowtie1 nor Bowtie2)

    Mandatory parameters:

    [ReadCount] database=miRNAs_miRBase20.gft

  44. Eduardo Andres Leon

    The problem:

    ERROR :: You are requesting a miRNA readcount analysis, but no aligned files are found (Neither Bowtie1 nor Bowtie2)

    Is related to the aligner folder. So taking into account the out_dir parameter inside your ini file, you should have a Bowtie2_results folder (if you used Bowtie2 aligner) or Bowtie1_results (if you used Bowtie1 aligner). Inside one of those folders you should have bam files.

    The regarding the targets.txt, you can't use - in the Name or the Type columns, I recommend you to use _ . The same in the contrast.txt. Once you modify the contrast you will know why you have to do this

    E

  46. Leila Kianmehr

    just one question, which aligner is better used for RNA-seq data in this analysis regard, bwa bowtie1 or 2 ?

    thanks in advance

  47. Eduardo Andres Leon

    I guess that you mean miRNASeq (no RNA-Seq). For a miRNASeq with read length < 50nt : Bowtie1. If read length> 50nt, then Bowtie 2

    BWA is for circRNAs

    Tophat/Hisat2/STAR for RNA-Seq

  48. Leila Kianmehr

    Hi No, I mean RNA-seq, according to miARma instructions I think, can use it for quantifying miRNA, isn't it?

  49. Eduardo Andres Leon

    Of course you can. If you see my previous post, for a RNA-Seq you can use Tophat/Hisat2/STAR.

    I believed you ask for a miRNA-Seq because in all your previous posts you were using a miRNA Analysis

  50. Leila Kianmehr

    yes, you are right, I was just starting with miARma examples, and now on my samples (RNA-seq), thank you

  51. Leila Kianmehr

    you said in previous posts that ERROR :: You are requesting a miRNA readcount analysis, but no aligned files are found (Neither Bowtie1 nor Bowtie2)

    Is related to the aligner folder. So taking into account the out_dir parameter inside your ini file, you should have a Bowtie2_results folder (if you used Bowtie2 aligner) or Bowtie1_results (if you used Bowtie1 aligner). Inside one of those folders you should have bam files. so for miRNA analysis of RNA-seq data just change aligner name and other comments are same?

  52. Eduardo Andres Leon

    Ummm I think I'm lost. Are you trying to do a miRNA analysis from RNA-Seq data ?

    If so, take into account that the protocol is quite different since for miRNAs there is a step to select just small RNAs (where mRNAs are discarded and only small RNAs are sequenced). So in a standard RNA-Seq most of the sequenced RNAs should be mRNAs.

    But if you want to try, use a miRNA analysis and a Bowtie2 aligner

  53. Leila Kianmehr

    Yes, I do. so what should I do to select just small RNA-seq from RNA-seq data? and do you have probably ini fle example or specific protocol for miRNA analysis by RNA-seq data?

  54. Eduardo Andres Leon

    No, I haven't. Nevertheless you can use the examples for a miRNA analysis, but using bowtie2 (I guess your reads are ~ 75nt). Regarding the adapter try first removing this section and if the reslts are not convincing, try again using the minion utility

  57. Leila Kianmehr

    I did but I get this error again ))-: , do you have any idea?

    "Bowtie2" Alignment Analysis finished ERROR :: You are requesting a miRNA readcount analysis, but no aligned files are found (Neither Bowtie1 nor Bowtie2)

    Mandatory parameters:

    [ReadCount] database=miRNAs_miRBase20.gft

  58. Eduardo Andres Leon

    Could you send me a screenshot with the result of:

    ls -lR XX?

    XX is the folder used as a parameter in the out_dir variable

  59. Leila Kianmehr

    sorry, what you mean? I haven't any folder with this name: XX, just I created 3 folders for miARma, 1 folder for bowtie2 indexes, 1 for data (include contrast, target and gff3 file and another results folder include 2 log file and xls file, I define results folder as out_dir, in this folder I dont have XX as a folder name!

  60. Eduardo Andres Leon

    As I posted: XX is the folder used as a parameter in the out_dir variable (inside the ini file)

  66. Eduardo Andres Leon

    Thanks ... So please confirm me 2 questions:

    1) You have fastq files inside: /media/leila/LaCie/Data_colorado/Series1/TR/

    2) the miARma binary is installed in /home/leila/apps/miARma/cbbio-miarma-42e187a7f514/

    (I recommend you to rename cbbio-miarma-42e187a7f514 to, for example, cbbio-miarma)

  68. Eduardo Andres Leon

    Perfecto so, could you please update de miaRmaPath line an execute the ini file that I'm pasting? :

    [General]
; type of analysis (miRNA, mRNA or circRNA)
type=miRNA
; Complete path where your raw reads are stored
read_dir=/media/leila/LaCie/Data_colorado/Series1/TR/
; label for the analsysis
label=Diet-effect
; Complete path where miARma has been installed
miARmaPath=/home/leila/apps/miARma/cbbio-miarma
; Complete path to store results
output_dir=/media/leila/LaCie/Data_colorado/Series1/miARma/results/
; organism used
organism=mouse
; Number of processes to run at the same time (adjust this value according to your hardware infrastructure and needs)
threads=4
; Whether the data is from a strand-specific assay (yes, no or reverse, yes by default) for featureCounts analysis
strand=yes
seqtype=Paired
verbose=1

[Aligner]
aligner=Bowtie2
; Absolute path to Bowtie indexes files + Basename
bowtie2index=/media/leila/LaCie/Data_colorado/Series1/miARma/Bowtie2-Index/mm10
  69. Eduardo Andres Leon

    this will create a new log and stat file.

    Could you send me both files once you try it ?

  72. Eduardo Andres Leon

    ahhhhh you have an error before starting the analysis .... Now I understand why logs are empty and there is no files inside the result folder.

    Si as the screenshots says, aligner expect de read pairs in a particular format. So all paired files must end with : R1.fastq or R2.fastq So in your example you have to rename F0F_MouseSperm_D_RNA_5_xxxxxx_L002_R1_001_1.fastq to : F0F_MouseSperm_D_RNA_5_xxxxxx_L002_R1.fastq (you have to do it for al R1 and R2 filenameS)

    Although I recommend you to use easier file names: F0F_D_5_R1.fastq/F0F_D_5_R2.fastq

  77. Eduardo Andres Leon

    As you wish. If you want to continue, use the same [General] section, comment the Aligner section and add the other sections (Readcount, DE_Analysis ...)

  78. Leila Kianmehr

    now I am getting this error:

    Error, fewer reads in file specified with -1 than in file specified with -2

    terminate called after throwing an instance of 'int' Aborted (core dumped)

    (ERR): bowtie2-align exited with value 134

    BOWTIE2 ERROR :: system args failed: 34304 (mkdir -p /media/leila/LaCie/Data_colorado/Series1/miARma/results//Bowtie2_results/ ;bowtie2 -p 4 -x /media/leila/LaCie/Data_colorado/Series1/miARma/Bowtie2-Index/mm10 -1 /media/leila/LaCie/Data_colorado/Series1/TR/F0N_D_3_1.fastq -2 /media/leila/LaCie/Data_colorado/Series1/TR/F0N_D_3_2.fastq --met-file /media/leila/LaCie/Data_colorado/Series1/miARma/results//Bowtie2_results/F0N_D_3_1.metrics -S --un /media/leila/LaCie/Data_colorado/Series1/miARma/results//Bowtie2_results/F0N_D_3_1_no_aligned.fastq -S /media/leila/LaCie/Data_colorado/Series1/miARma/results//Bowtie2_results/F0N_D_3_1_nat_bw2.bam) at /home/leila/apps/miARma/cbbio-miarma/lib/CbBio/RNASeq/Aligner.pm line 1536.

  79. Eduardo Andres Leon

    That seems weird ... can you count the number of reads of each file ?:

    wc -l /media/leila/LaCie/Data_colorado/Series1/TR/F0N_D_3_1.fastq

    and

    wc -l /media/leila/LaCie/Data_colorado/Series1/TR/F0N_D_3_2.fastq

    They should be the same number

  80. Leila Kianmehr

    Hi Eduardo

    I did it, here I put the results

    /media/leila/LaCie/Data_colorado/Series1/TR$ wc -l F0N_D_3_1.fastq 57878221 F0N_D_3_1.fastq

    /media/leila/LaCie/Data_colorado/Series1/TR$ wc -l F0N_D_3_2.fastq 57878461 F0N_D_3_2.fastq they are not same!

  81. Eduardo Andres Leon

    Are these fastq file processed ? (may be the bcl2fastq utility ?) Please check in the summary file if the read length of the samples are the same in all files

  83. Leila Kianmehr

    one thing, just for miARma analysis can be done faster with these huge data, can I align fastq files with bowtie 1 on the server and then put the bam file in miARma path?

  84. Eduardo Andres Leon

    And why not, use miARma on the server ? you can specify the number of threads to be used

  85. Leila Kianmehr

    No, because I need R package on the server and I am not the user, cant install R on the server for miARma to use that

  86. Eduardo Andres Leon

    well in that case use the Aligner and Readcount in the server and then copy de Readcount_results folder in your desktop to proceed with the DE_Analysis

  90. Leila Kianmehr

    I get this error with feaurecounts

    Load annotation file mmu.gff3 ... || || Features : 0 || || WARNING no features were loaded in format GTF. || || annotation format can be specified using '-F'. || Failed to open the annotation file /home/lkianmehr/mmu.gff3, or its format is incorrect, or it contains no 'exon' features.

  91. Eduardo Andres Leon

    are you sing the parameters:

    seqid=Name featuretype=miRNA_primary_transcript

    That we check ?

  94. Leila Kianmehr

    ahhh, yes. sorry. I am using this command for featurecounts:

    featureCounts -a ~/mmu.gff3 -o ~/Series1/Featurebt2 F0F_MouseSperm_D_RNA_5_TCCGCGAA-CAGGACGT_L002_R1_001.sam

  95. Eduardo Andres Leon

    but this is not miARma related.

    Use miARma in the server to align and count reads. Then the Reacount_results created in the server can be used by miARma in your desktop computer

  96. Leila Kianmehr

    you mean just use aligner and readcount section by miARma on the server, I've installed it separately on the server without miARma!

  98. Leila Kianmehr

    I get this error on the server with miARma:

    Can't locate CbBio/RNASeq/miARma.pm in @INC (@INC contains: /home/lkianmehr/miAR/lib/ /usr/local/lib64/perl5 /usr/local/share/perl5 /usr/lib64/perl5/vendor_perl /usr/share/perl5/vendor_perl /usr/lib64/perl5 /usr/share/perl5 .) at ./miARma line 88. BEGIN failed--compilation aborted at ./miARma line 88.

  101. Eduardo Andres Leon

    check if it is well written in the ini file (miARmaPath), because the software is looking for its internal packages in /home/lkianmehr/miAR/lib/ (see your previous post)

  102. Leila Kianmehr

    Hi,

    I came again (-: with one question! Eduardo, I did Alignment and read count part of miARma on the server, I just checked the results, read count is done by installed feature count on the server (from SUBREAD package), not that one on miARma package. is it Ok in your idea? or remove feature count on the server and run miARma again to be done by miARma feature count?

  103. Eduardo Andres Leon

    Hi Leila,

    I recommend you to use miARma (and miARma binaries). Our pipeline uses featurecount to quantity the expression but then, all results created by featurecounts are processed to be used in the DE_Analysis part. If you used the featurecoutns by your own, miARma will not be able to continue in the next step (DE_Analysis)

    E

  104. Leila Kianmehr

    Dear Eduardo

    I am going to put the results of Alignment and readcount analysis on my linux, so just DE analysis part should be performed? or before partitions also should be in ini file? thanks in advance

  105. Eduardo Andres Leon

    You don't need the aligned files (sam/bam).

    if you have used miARma to perfom the ReadCount step, yo only need to copy the folder Readcount_results (this folder only contais 2 files)

  107. Eduardo Andres Leon

    Yes. The [General] section is mandatory in all ini files. Then you have to include one or more sections to perform the analysis

  108. Leila Kianmehr

    I was doing final step on Linux that got this error: Continue. [Wed Jul 25 16:34:18 2018] All parameters are correct. [Wed Jul 25 16:34:18 2018] Starting a differential expression analysis using EdgeR software(s) Problem while running this R command: print(resultsfiles)

    Error: print(resultsfiles) : object 'resultsfiles' not found Execution halted

    could you please tell me it's the reason?

  109. Eduardo Andres Leon

    This is the most common R with miARma, most of the time is related the target and the contrast file.

    Could you please send me both logfiles + targets.txt + contrast.txt for this particular experiment?

    Thanks

  115. Eduardo Andres Leon

    Sorry, I'm finishing some stuff before holydays (that starts today). ...

    Take a look to the targets.txt. All columns mas be separated by tabs. The line with: F0N_D_RNA_3_2 F0N_D_RNA_3_2 F0NDRNA3

    is splitted by spaces

  116. Leila Kianmehr

    Excuse me Eduardo, wish you the best holidays! I know that should not bother you in holidays but I need you to help to finish this analysis

    I did it and split by tabs but get the same error again!

  118. Eduardo Andres Leon

    The target seems correct to me. The contrast is not, you have to use a different label for each comparison

    Name Comp1=F0NDRNA3-F0FDRNA5 Comp2=F0NRNA3-F0FDRNA5 Comp3=F0NDRNA3-F1FDRNA8 Comp4=F0NRNA3-F1FRNA8

  123. Eduardo Andres Leon

    Could you try the following ?:

    bash$>cd /media/leila/LaCie/Data_colorado/Series1/miARma/results/
R$>R
R$>source("/home/leila/apps/miARma/cbbio-miarma/lib/CbBio/RNASeq/R-Scripts/QC_EdgeR.R") 
R$>setwd("/media/leila/LaCie/Data_colorado/Series1/miARma/results/Readcount_results")
R$>QC_EdgeR(projectdir="/media/leila/LaCie/Data_colorado/Series1/miARma/results",dir="/media/leila/LaCie/Data_colorado/Series1/miARma/results/Readcount_results", file="nat_bw2-ReadCount.tab", targetfile="/media/leila/LaCie/Data_colorado/Series1/miARma/data/targets.txt", label="Diet-effect_nat_bw2", filter="yes")
  124. Leila Kianmehr

    Dear Eduardo, I followed the command and got this error in below, what does mean exactly?

    Error in DGEList(counts = data, group = group) : Length of 'group' must equal number of columns in 'counts'

  125. Eduardo Andres Leon

    That means that the number of processed samples is different from the samples specified in the target file.

    Could you include a screenshot of the files inside nat_bw2_results ?

  127. Eduardo Andres Leon

    In your targets.txt you have defined 16 samples, but according with your screenshot you only have 8. In the targets.txt you are using R1 and R2 as two2 samples but this is ONE sample sequenced in a paired way. So there are only 8 samples to be compared.

    And please take always one thing into account, in order to compare two groups, each groups must have at least 2 different samples

  128. Leila Kianmehr

    Dear Eduardo

    yes, you're right. I had defined paired read names in the target file instead of the name of their Aligned file, I have just 8 aligned files. I have 2 sample for each one F0N, F0F, and F1F but they are not the same. one of them is DNA associated RNA and another free-RNA Do I want to compare them together in the order of contrast file? what changes are needed in the contrast file exactly? because I changed the target file as in attach but get the same error!

    thanks in advance

  129. Eduardo Andres Leon

    If you see your target file, there is only one sample for each group ( column type in the targets.txt). You need 2 samples for each group to perform a differential expression analysis

  130. Leila Kianmehr

    Sorry, I can't understand, because we have 2 sample for each one of F0F, F0N, and F1F. so why I can't compare them together and with others?

  131. Leila Kianmehr

    We need to compare: 1- F0N D-RNA3 / to F0F-D-RNA5

    2- F0N –RNA3 / to F0F- RNA5

    3- F0N D-RNA3 / to F1F-D-RNA8

    4- F0N RNA3 / to F1F- RNA8

    5- F0F D-RNA5 / to F1F-D-RNA8

    6- F0F RNA5 / to F1F-RNA8

    and we have 1 sequence for each one! so I can't use just miARma for that or also other DGE analysis software like that?

  133. Eduardo Andres Leon

    It should be ok. I have no computer until August 16th so I can’t check the spaces/tabs .... But try the pipeline and let me know

  136. Leila Kianmehr

    Hello Eduardo

    Hope you have a great holidays!

    I wanted to ask you a question about miARma! I have 3 series data from mouse samples, I want to know for comparing them should I put all reads together in one folder and run it at the same time or can analyze them separately by miArma and finally put all final results in one count file for DE analysis? is it possible?

    thanks in advance

    Leila

  137. Eduardo Andres Leon

    Hi, In order to help you I need the log files (stats and log).

    Regarding the other question: You can proceed in a similar way that you have done before, that is: you can use miARma to do most of the steps (quality, preprocessing, alignment ...), but the Readcount part should be performed together to create the file needed in the DEAnalysis section

  138. Leila Kianmehr

    Hello

    Now I am going to continue with DE analysis on my system, I an getting this error: Problem while running this R command: print(resultsfiles)

    Error: print(resultsfiles) : object 'resultsfiles' not found Execution halted

    according to log file, exact error is :

    Starting quality control analysis of Diet-effect_nat_bw2 Error in contrasts<-(*tmp*, value = contr.funs[1 + isOF[nn]]) : contrasts can be applied only to factors with 2 or more levels

    I will attach the required documents. thanks for your help. I was looking forward to hearing from you!

  141. Eduardo Andres Leon

    It seems that you are using paired files as different samples:

     D1_L001_1  D1_L001 WND  
 D1_L002_1  D1_L002 WND

    These 2 files could come for 1 sample ?

    Besides, try to open the file Diet-effect_nat_bw2.tab (inside Readcount_results) and check that the number of columns is the same that the number of lines in the targets.txt

  144. Eduardo Andres Leon

    try to open the file Diet-effect_nat_bw2.tab (inside Readcount_results) and check that the number of columns is the same that the number of lines in the targets.txt

  146. Eduardo Andres Leon

    that is correct.

    Could you remove the empty lines at the end of the contrast.txt file ?

  148. Eduardo Andres Leon

    There is still an empty line .... This is the only thing I see "strange", cause everything seems to be fine

  150. Eduardo Andres Leon

    Without taking into account that the first line is missing, there is an empty line (intro) after Comp_5=DND-WHF

  152. Leila Kianmehr

    Dear Eduardo

    Hi, I got this error when running ini file for readcount analysis, could you please resolve it?

    SEQCOUNT ERROR :: system args failed: 65280 (mkdir -p miAall/results/Bowtie2_HS_results//nat_bw2_readcount_results/ ;featureCounts -s 1 -t miRNA_primary_transcript -g Name -T 80 -p -a miAall/data/hsa.gff3 -o miAall/results/Bowtie2_HS_results//nat_bw2_readcount_results/D_RNA_1_nat_bw2.tab miAall/results/Bowtie2_HS_results//Bowtie2_results/D_RNA_1_nat_bw2.bam 2>> miAall/results/Bowtie2_HS_results//miARma_logfile.4949.log) at lib//CbBio/RNASeq/Readcount.pm line 200.

  154. Log in to comment
Assignee
–
Type
bug
Priority
major
Status
resolved
Votes
0
Watchers
1
Jira: the preferred issue tracker for Bitbucket. Join the team!