Top level links:

• Main top level page for all documentation
• EnteroBase Features
• Registering on EnteroBase and logging in
• Tutorials
• Using the API
• About the underlying pipelines and other internals
• How schemes in EnteroBase work
• FAQ

NServ

Overview

NServ is a standalone server that can handle all the requests related to MLST, cgMLST and other MLST schemes, across all the taxa handled in EnteroBase. It offers sets of APIs to both communicate with users and bioinformatic tools, and synchronize MLST data with existing MLST websites (currently only MLST UoW).

NServ is still under development. The current tool for MLST typing is a task named "nomenclature" implemented in EnteroTools.

API

NServ URI

In the examples below, the NServ URI is configuration dependent, depending on which system NServ runs.

Query methods (walking through database structure)

Database query

In order to get a list of all current databases make an HTTP GET request using the URL

http://<NServ Host>/ET/NServ/query.api

Table query

In order to get all available tables in a database, for example the Salmonella database use the URL

http://<NServ Host>/ET/NServ/query.api/Salmonella

Index/ within-table query

To get all indexes in a table, for example the alleles table in the Salmonella database use the URL

http://<NServ Host>/ET/NServ/query.api/Salmonella/alleles

Record/ query lookup

In order to get information for a specific record, for example the record with index 100 in the alleles table of the Salmonella database

http://<NServ Host>/ET/NServ/query.api/Salmonella/alleles/100

Retrieve methods (Find information with barcodes)

Barcode lookup

In order to get information directly from a barcode, for example the barcode SAL_AA0100AA_ST use the URL

http://<NServ Host>/ET/NServ/retrieve.api/SAL_AA0100AA_ST>
( Alternatively, you can POST lots of barcodes at one batch in this format:
http://<NServ Host>/ET/NServ/retrieve.api?barcode=SAL_AA0002AA_LO

Lookup of historical archives for a barcode

For example, in order to get all historical archives for the barcode SAL_AA0002AA_LO use the URL

http://<NServ Host>/ET/NServ/retrieve.api/SAL_AA0002AA_LO/archives

#Currently no history

Lookup of a historical version for a barcode

For example, in order to get the historical version 1 for the barcode SAL_AA0002AA_LO use the URL

http://<NServ Host>/ET/NServ/retrieve.api/SAL_AA0002AA_LO/archives?version=1

#Currently no history

Dedicated search methods (batch downloads or specified queries)

Search for alleles for a given locus

For example, in order to download all alleles for locus “aroC” in Salmonella MLST scheme use

1. http://<NServ Host>/ET/NServ/search.api/Salmonella/UoW/alleles?filter=fieldname%20in%20('aroC')
   or
2. http://<NServ Host>/ET//NServ/search.api/Salmonella/UoW/alleles?locus=aroC
   Both the database name and the table name are required.

More complex queries for alleles

The searching criteria can be submitted with either filter=“SQL statement”, or key=value pairs, or a combination of these two ways. For example, downloading only the first five alleles:

1. http://<NServ Host>/ET/NServ/search.api/Salmonella/UoW/alleles?locus=aroC&filter=allele_id between 1 and 5
   search.api also supports complex search terms like :
2. http://<NServ Host>/ET/NServ/search.api/Salmonella/UoW/alleles?locus=aroC&allele_id=between 1 and 5

Search for allele with a specific sequence

An example of a search for a known allele id - in the Salmonella database with the exact sequence (see below) is given by the URL

http://<NServ Host>/ET/NServ/search.api/Salmonella/UoW/alleles?locus=aroC&seq=GTTTTTCGCCCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCT

Matching methods (finds alleles with sequence, or finds STs with alleles)

match.api queries not documented yet...